Incidental Mutation 'R9130:Mettl4'
ID 693590
Institutional Source Beutler Lab
Gene Symbol Mettl4
Ensembl Gene ENSMUSG00000055660
Gene Name methyltransferase like 4
Synonyms HsT661, A730091E08Rik, 2410198H06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R9130 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 94727080-94749892 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94735485 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 308 (I308L)
Ref Sequence ENSEMBL: ENSMUSP00000127142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171284]
AlphaFold Q3U034
Predicted Effect possibly damaging
Transcript: ENSMUST00000171284
AA Change: I308L

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127142
Gene: ENSMUSG00000055660
AA Change: I308L

DomainStartEndE-ValueType
Pfam:MT-A70 280 454 9.9e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,451,927 C585R possibly damaging Het
Acaca T C 11: 84,311,319 L1380S probably damaging Het
Aifm2 A C 10: 61,727,726 Q125P probably null Het
Ak5 A T 3: 152,472,932 L482* probably null Het
Aldh3a2 T C 11: 61,248,932 Q458R probably benign Het
Ank2 G A 3: 127,016,916 T524I Het
Apoc3 A T 9: 46,235,183 S25T unknown Het
Ash1l A T 3: 89,058,541 R2417* probably null Het
Bbs12 A G 3: 37,319,056 probably benign Het
Birc6 T A 17: 74,612,151 I1992N Het
Brd9 G A 13: 73,944,787 V299M probably damaging Het
Brwd1 A T 16: 96,064,930 N217K probably damaging Het
C3 T C 17: 57,211,678 Y1235C probably damaging Het
Cacna1c T C 6: 118,613,946 Y1538C Het
Ccdc172 T A 19: 58,537,347 H212Q possibly damaging Het
Cdc6 A G 11: 98,912,173 D313G probably damaging Het
Cyp2e1 T C 7: 140,773,109 V353A probably damaging Het
Dlg2 G T 7: 92,431,050 V711F probably damaging Het
Dmac2 T C 7: 25,621,023 F49S probably damaging Het
Dnah7b A G 1: 46,134,514 K660E probably benign Het
Dusp8 A T 7: 142,088,418 S106T probably benign Het
Dynll1 T A 5: 115,300,545 I34F probably benign Het
Epb41l4b A G 4: 57,103,447 F130L possibly damaging Het
Erc2 T C 14: 28,029,461 Y705H probably benign Het
Exosc8 T A 3: 54,731,082 L160F probably damaging Het
F5 A G 1: 164,174,261 T178A probably benign Het
F7 C A 8: 13,035,059 P362T probably damaging Het
Fkbp3 T C 12: 65,065,793 K156E possibly damaging Het
Folh1 G A 7: 86,719,705 T738I probably benign Het
Gatad2b C T 3: 90,348,629 A134V probably benign Het
Glud1 T A 14: 34,335,392 W338R Het
Gm21149 T C 5: 15,475,263 K62E possibly damaging Het
Gm32742 A G 9: 51,138,749 Y1517H probably damaging Het
Gse1 A T 8: 120,568,313 E391V unknown Het
Gxylt2 C T 6: 100,733,368 Q157* probably null Het
Hbq1b C T 11: 32,287,092 T27I probably damaging Het
Hoxd13 T A 2: 74,669,038 D243E probably benign Het
Hsd3b3 T A 3: 98,743,895 I80F possibly damaging Het
Kat14 T C 2: 144,373,822 F76L probably benign Het
Kdm6b T C 11: 69,404,598 T948A unknown Het
Kmt2c A T 5: 25,311,104 H2580Q probably benign Het
Lrp1 T C 10: 127,546,412 T3727A probably benign Het
Lrrc8a A G 2: 30,257,030 I619V possibly damaging Het
Mansc1 C A 6: 134,609,988 G409W probably damaging Het
Map3k11 C A 19: 5,696,010 L418I possibly damaging Het
Myo9a A G 9: 59,832,231 D742G probably damaging Het
Mypn T C 10: 63,192,873 Q137R probably benign Het
Neurod4 A T 10: 130,270,558 Y282* probably null Het
Nup210 A G 6: 91,043,817 F965S probably benign Het
Olfr1031 T G 2: 85,992,475 Y219* probably null Het
Olfr1271 A G 2: 90,266,014 C139R probably damaging Het
Olfr374 G T 8: 72,109,853 G96C probably damaging Het
Olfr780 A G 10: 129,322,028 N135S probably benign Het
Oplah T C 15: 76,300,898 T872A possibly damaging Het
Pkn2 A T 3: 142,809,484 D696E possibly damaging Het
Plpp1 A T 13: 112,851,504 I54L Het
Ppp4r2 T G 6: 100,865,152 N191K probably damaging Het
Ptpdc1 G T 13: 48,586,179 P592Q probably benign Het
Qrich2 A T 11: 116,456,866 L1044* probably null Het
Rb1cc1 A G 1: 6,244,885 I421V probably damaging Het
Ripor3 A T 2: 167,981,347 C881* probably null Het
Rreb1 T C 13: 37,930,306 F547S probably benign Het
Scel T C 14: 103,533,310 V60A probably benign Het
Shank3 G A 15: 89,558,216 A1771T probably benign Het
Slc6a20a A G 9: 123,640,566 probably null Het
Slfn5 C T 11: 82,960,620 T581I probably damaging Het
Ssh3 A C 19: 4,264,085 V412G probably damaging Het
Sun3 T G 11: 9,018,170 T274P probably benign Het
Tm9sf1 T C 14: 55,638,007 T427A probably damaging Het
Tmem114 T A 16: 8,412,119 I140F Het
Tmem40 T C 6: 115,734,019 R167G possibly damaging Het
Top3a C A 11: 60,750,575 probably null Het
Trafd1 A G 5: 121,378,510 V210A probably benign Het
Trim66 T C 7: 109,477,689 I348V possibly damaging Het
Ttn G A 2: 76,848,828 A10850V unknown Het
Unc80 G A 1: 66,638,085 A2058T possibly damaging Het
Upp2 T C 2: 58,778,008 Y238H probably damaging Het
Vmn1r224 T A 17: 20,419,980 I273N probably damaging Het
Vps13c T C 9: 67,929,523 S1768P probably damaging Het
Zfp26 G A 9: 20,437,427 H614Y probably damaging Het
Zfp263 C T 16: 3,749,837 T672I probably benign Het
Zfp641 T A 15: 98,288,851 Q297L probably benign Het
Zfp944 T C 17: 22,341,050 E25G probably damaging Het
Zfp994 T C 17: 22,200,000 E656G unknown Het
Zfyve19 A G 2: 119,214,849 D206G probably damaging Het
Other mutations in Mettl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03376:Mettl4 APN 17 94735371 missense probably damaging 1.00
R1938:Mettl4 UTSW 17 94747857 missense possibly damaging 0.76
R2172:Mettl4 UTSW 17 94733163 missense probably benign
R2370:Mettl4 UTSW 17 94733148 missense probably damaging 1.00
R3621:Mettl4 UTSW 17 94735508 missense probably damaging 1.00
R3913:Mettl4 UTSW 17 94740532 missense probably benign 0.06
R4155:Mettl4 UTSW 17 94740575 missense probably benign
R4536:Mettl4 UTSW 17 94735505 missense possibly damaging 0.79
R4946:Mettl4 UTSW 17 94740532 missense probably benign 0.06
R5263:Mettl4 UTSW 17 94740509 nonsense probably null
R5397:Mettl4 UTSW 17 94727277 nonsense probably null
R6242:Mettl4 UTSW 17 94735374 missense probably damaging 1.00
R6508:Mettl4 UTSW 17 94743945 missense probably damaging 0.98
R7069:Mettl4 UTSW 17 94733633 missense probably damaging 0.98
R7941:Mettl4 UTSW 17 94733194 splice site probably null
R8088:Mettl4 UTSW 17 94735367 missense probably damaging 1.00
R8373:Mettl4 UTSW 17 94733649 missense probably damaging 1.00
R8710:Mettl4 UTSW 17 94733644 missense probably damaging 0.99
R9055:Mettl4 UTSW 17 94740415 missense possibly damaging 0.65
R9335:Mettl4 UTSW 17 94735508 missense probably damaging 1.00
Z1176:Mettl4 UTSW 17 94733563 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTCAGCATCTTCCTGGAAGTG -3'
(R):5'- GTGTAAGTGCCAGTGAGTCCAC -3'

Sequencing Primer
(F):5'- TCAGCATCTTCCTGGAAGTGAAAAG -3'
(R):5'- GGCTCCTAGACCTTTGTA -3'
Posted On 2022-01-20