Incidental Mutation 'R9131:Pikfyve'
ID 693595
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms Pip5k3
Accession Numbers

Genbank: NM_011086

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 65186683-65278695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65246080 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 826 (M826K)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: M781K

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: M826K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: M826K

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190058
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,508 Y148F possibly damaging Het
Adamtsl3 A G 7: 82,595,514 T1393A probably benign Het
Adgrf4 G T 17: 42,667,367 Q362K probably benign Het
Akr1d1 A G 6: 37,554,516 K163R probably benign Het
Arhgap42 A G 9: 9,011,363 L474P probably damaging Het
Arhgef18 G A 8: 3,437,007 R242Q possibly damaging Het
Asah1 A G 8: 41,354,012 probably null Het
Atm A T 9: 53,533,744 I34N probably benign Het
Brms1l A G 12: 55,860,128 E160G possibly damaging Het
Camk2a C T 18: 60,943,255 H102Y unknown Het
Cd300lb A G 11: 114,928,308 V165A probably damaging Het
Cela1 G A 15: 100,681,157 R207C probably benign Het
Chd7 T C 4: 8,785,642 S649P Het
Clic3 A G 2: 25,458,313 Q130R probably benign Het
Clns1a G A 7: 97,713,918 G166R probably damaging Het
Cngb1 A T 8: 95,253,265 H1002Q probably benign Het
Cnnm1 C A 19: 43,441,400 A319E probably benign Het
Cntnap5b C T 1: 100,050,643 T128I probably benign Het
Csf3r G A 4: 126,030,020 D108N probably benign Het
Ctsc G A 7: 88,309,808 W432* probably null Het
Dapk1 G A 13: 60,761,394 G1274R probably damaging Het
Dennd2c C A 3: 103,157,715 P718Q probably damaging Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah7b C T 1: 46,227,020 R2250C probably damaging Het
Dnmt3a A T 12: 3,866,136 Q107L probably benign Het
Eml2 A G 7: 19,184,826 D67G Het
Eml5 A T 12: 98,858,840 V706E probably damaging Het
Eps8l1 A G 7: 4,477,574 D509G Het
Farsb T C 1: 78,483,314 K43E probably benign Het
Fbxw20 A G 9: 109,223,446 F273S probably damaging Het
Fig4 A T 10: 41,265,411 F284Y possibly damaging Het
Fsd1l C A 4: 53,694,756 N403K probably damaging Het
Fsip2 A T 2: 82,982,826 H3163L probably benign Het
Gm38119 C A 3: 92,738,096 G64* probably null Het
Gpr18 A G 14: 121,911,761 V284A probably benign Het
Hacd3 A G 9: 65,001,004 V170A probably damaging Het
Hps3 T C 3: 20,029,186 E281G probably damaging Het
Ick A T 9: 78,166,948 S551C possibly damaging Het
Ighv12-3 A C 12: 114,366,926 V10G probably benign Het
Lrp1b G A 2: 40,699,578 R3862* probably null Het
Ltbp4 A G 7: 27,337,551 L6P unknown Het
Ly6h T A 15: 75,565,673 T53S probably damaging Het
Ly6i A G 15: 74,983,157 probably benign Het
Mat2a G A 6: 72,436,244 R168C probably damaging Het
Mdn1 T A 4: 32,762,275 D5066E possibly damaging Het
Med23 T A 10: 24,904,381 F976I Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Mylk G T 16: 34,956,465 C1336F probably benign Het
Myo9a G C 9: 59,861,489 R918P probably damaging Het
Naglu T A 11: 101,076,905 D560E probably damaging Het
Nrg2 C T 18: 36,024,343 V430M probably damaging Het
Oit3 T C 10: 59,435,929 N202S probably benign Het
Olfr1453 T A 19: 13,027,996 Y111F probably benign Het
Olfr211 A G 6: 116,493,920 T104A probably benign Het
Olfr389 A T 11: 73,777,324 M1K probably null Het
Olfr569 T C 7: 102,887,979 H58R probably benign Het
Olfr766-ps1 C A 10: 129,063,228 V260F probably damaging Het
Otog T A 7: 46,303,173 C423* probably null Het
Pcolce T A 5: 137,605,508 T401S probably benign Het
Pcsk2 T C 2: 143,813,663 M589T possibly damaging Het
Pik3r5 T C 11: 68,492,273 L306P possibly damaging Het
Ppp1r9a A G 6: 5,134,106 R898G possibly damaging Het
Prl7b1 A G 13: 27,606,985 V39A probably benign Het
Pros1 T A 16: 62,928,034 D623E probably damaging Het
Psg16 A G 7: 17,098,099 D320G probably benign Het
Ptpre T A 7: 135,679,146 H612Q probably damaging Het
Rbm34 A G 8: 126,953,178 S283P probably damaging Het
Rc3h2 A T 2: 37,414,690 N19K possibly damaging Het
Sacm1l T A 9: 123,552,762 L143* probably null Het
Sept9 T A 11: 117,290,634 S105T probably damaging Het
Shprh T C 10: 11,162,845 M448T possibly damaging Het
Slc6a20a A C 9: 123,636,998 *593E probably null Het
Smarcc1 A G 9: 110,135,642 D89G possibly damaging Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Tanc2 T C 11: 105,798,777 V255A probably benign Het
Tiam1 A G 16: 89,860,267 S694P probably damaging Het
Tmem130 T C 5: 144,743,719 T292A Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,214,377 probably benign Het
Tpcn2 A G 7: 145,260,925 Y480H probably damaging Het
Trf G T 9: 103,211,888 A600D probably damaging Het
Ttc16 A T 2: 32,769,220 L346Q probably damaging Het
Vars A C 17: 35,004,797 K229N possibly damaging Het
Vmn1r113 G T 7: 20,787,417 G45C probably damaging Het
Vmn1r32 A G 6: 66,553,036 V252A probably benign Het
Vmn2r93 A G 17: 18,325,881 T672A probably damaging Het
Wdfy4 T A 14: 33,097,850 T1466S Het
Zcwpw1 T C 5: 137,810,920 Y317H probably damaging Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp273 A T 13: 67,825,566 H271L probably damaging Het
Zfp764 C A 7: 127,406,547 E20* probably null Het
Znfx1 A T 2: 167,050,378 N639K probably benign Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65260121 critical splice donor site probably null
IGL01135:Pikfyve APN 1 65251635 missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65258869 nonsense probably null
IGL01759:Pikfyve APN 1 65253353 missense probably benign 0.06
IGL01888:Pikfyve APN 1 65223640 missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65264365 missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65238544 critical splice donor site probably null
IGL02119:Pikfyve APN 1 65272571 missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65246397 missense probably benign 0.13
IGL02207:Pikfyve APN 1 65251678 critical splice donor site probably null
IGL02380:Pikfyve APN 1 65256021 missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65252569 missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65244504 missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65251612 missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65264376 missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65230855 critical splice donor site probably null
IGL02746:Pikfyve APN 1 65234272 missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65250194 nonsense probably null
IGL02890:Pikfyve APN 1 65230797 missense probably benign 0.00
IGL03102:Pikfyve APN 1 65252467 nonsense probably null
IGL03294:Pikfyve APN 1 65247067 missense probably damaging 1.00
falcon UTSW 1 65196741 missense probably damaging 1.00
oompa UTSW 1 65196706 missense probably damaging 1.00
wonka UTSW 1 65196706 missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65202916 missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65215929 splice site probably benign
R0196:Pikfyve UTSW 1 65256072 missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65262905 missense probably benign 0.41
R0319:Pikfyve UTSW 1 65246331 missense probably benign 0.01
R0332:Pikfyve UTSW 1 65264399 missense probably benign 0.02
R0389:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65219899 missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65253523 missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65253397 missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65265824 missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65246959 missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65271311 missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65224201 missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65262977 critical splice donor site probably null
R1501:Pikfyve UTSW 1 65265284 missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65252548 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65192271 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65246370 missense probably benign
R1795:Pikfyve UTSW 1 65252557 missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65258798 missense probably benign 0.03
R1905:Pikfyve UTSW 1 65192295 critical splice donor site probably null
R1995:Pikfyve UTSW 1 65246708 missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65222357 missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65253353 missense probably benign 0.06
R2229:Pikfyve UTSW 1 65267855 missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65246676 missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65253517 missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65245758 missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65244420 missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65230845 missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65196681 missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65190520 unclassified probably benign
R4542:Pikfyve UTSW 1 65244430 missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65192192 missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65234262 missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65267846 missense probably benign
R4716:Pikfyve UTSW 1 65246476 missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65272515 missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65267846 missense probably benign
R4785:Pikfyve UTSW 1 65267846 missense probably benign
R4805:Pikfyve UTSW 1 65268800 missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65196741 missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65246590 missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65224117 intron probably benign
R5265:Pikfyve UTSW 1 65267829 missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65196699 nonsense probably null
R5384:Pikfyve UTSW 1 65244409 missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65265268 missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65235033 missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65252495 missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65273730 missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65256088 missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65216028 missense probably benign 0.09
R5891:Pikfyve UTSW 1 65202737 missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65253438 nonsense probably null
R6026:Pikfyve UTSW 1 65272697 missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65272571 missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65216043 missense probably benign 0.36
R6287:Pikfyve UTSW 1 65253532 critical splice donor site probably null
R6290:Pikfyve UTSW 1 65202925 critical splice donor site probably null
R6296:Pikfyve UTSW 1 65262953 missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65265781 missense probably benign 0.35
R6835:Pikfyve UTSW 1 65258843 missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65252530 missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65246663 missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65234361 missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65246854 missense probably benign 0.01
R7057:Pikfyve UTSW 1 65247205 missense probably benign 0.00
R7525:Pikfyve UTSW 1 65244426 nonsense probably null
R7558:Pikfyve UTSW 1 65272623 missense probably benign 0.01
R7625:Pikfyve UTSW 1 65267877 missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65269942 missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65265789 missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65246395 missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65253342 splice site probably benign
R8307:Pikfyve UTSW 1 65245735 missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65215996 missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65244417 missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65271268 missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65246970 missense probably benign 0.00
R8995:Pikfyve UTSW 1 65205587 critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65244400 missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65196739 missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65252560 missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65252560 missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65260029 missense probably benign 0.37
R9368:Pikfyve UTSW 1 65268742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCACTCAGTTAGGGACCTCAAG -3'
(R):5'- GCATTAATGTTGGAGGCATAGCG -3'

Sequencing Primer
(F):5'- CCTCAAGGAGAAGTGAGTCATCTCTG -3'
(R):5'- TTGGAGGCATAGCGAACTCATCC -3'
Posted On 2022-01-20