Incidental Mutation 'R9131:Ppp1r9a'
ID 693617
Institutional Source Beutler Lab
Gene Symbol Ppp1r9a
Ensembl Gene ENSMUSG00000032827
Gene Name protein phosphatase 1, regulatory subunit 9A
Synonyms NRB, neurabin-I, Neurabin I, A230094E16Rik, 4930518N04Rik, 2810430P21Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R9131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 4902917-5165661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5134106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 898 (R898G)
Ref Sequence ENSEMBL: ENSMUSP00000135629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000175889] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177456]
AlphaFold H3BJD6
Predicted Effect possibly damaging
Transcript: ENSMUST00000035813
AA Change: R898G

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: R898G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175889
AA Change: R898G

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: R898G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1041 1.72e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176263
AA Change: R920G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: R920G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
low complexity region 643 649 N/A INTRINSIC
Blast:PDZ 763 800 2e-15 BLAST
low complexity region 806 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176729
SMART Domains Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 96 115 N/A INTRINSIC
PDB:3HVQ|D 116 232 4e-79 PDB
SCOP:d1be9a_ 174 232 5e-9 SMART
Blast:PDZ 193 232 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177153
AA Change: R898G

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: R898G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177456
AA Change: R898G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: R898G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1040 1049 N/A INTRINSIC
low complexity region 1103 1114 N/A INTRINSIC
SAM 1183 1249 6.41e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,160,075 (GRCm39) Y148F possibly damaging Het
Adamtsl3 A G 7: 82,244,722 (GRCm39) T1393A probably benign Het
Adgrf4 G T 17: 42,978,258 (GRCm39) Q362K probably benign Het
Akr1d1 A G 6: 37,531,451 (GRCm39) K163R probably benign Het
Arhgap42 A G 9: 9,011,364 (GRCm39) L474P probably damaging Het
Arhgef18 G A 8: 3,487,007 (GRCm39) R242Q possibly damaging Het
Asah1 A G 8: 41,807,049 (GRCm39) probably null Het
Atm A T 9: 53,445,044 (GRCm39) I34N probably benign Het
Brms1l A G 12: 55,906,913 (GRCm39) E160G possibly damaging Het
Camk2a C T 18: 61,076,327 (GRCm39) H102Y unknown Het
Cd300lb A G 11: 114,819,134 (GRCm39) V165A probably damaging Het
Cela1 G A 15: 100,579,038 (GRCm39) R207C probably benign Het
Chd7 T C 4: 8,785,642 (GRCm39) S649P Het
Cilk1 A T 9: 78,074,230 (GRCm39) S551C possibly damaging Het
Clic3 A G 2: 25,348,325 (GRCm39) Q130R probably benign Het
Clns1a G A 7: 97,363,125 (GRCm39) G166R probably damaging Het
Cngb1 A T 8: 95,979,893 (GRCm39) H1002Q probably benign Het
Cnnm1 C A 19: 43,429,839 (GRCm39) A319E probably benign Het
Cntnap5b C T 1: 99,978,368 (GRCm39) T128I probably benign Het
Csf3r G A 4: 125,923,813 (GRCm39) D108N probably benign Het
Ctsc G A 7: 87,959,016 (GRCm39) W432* probably null Het
Dapk1 G A 13: 60,909,208 (GRCm39) G1274R probably damaging Het
Dennd2c C A 3: 103,065,031 (GRCm39) P718Q probably damaging Het
Dmxl1 C G 18: 50,072,639 (GRCm39) N2744K probably damaging Het
Dnah7b C T 1: 46,266,180 (GRCm39) R2250C probably damaging Het
Dnmt3a A T 12: 3,916,136 (GRCm39) Q107L probably benign Het
Eml2 A G 7: 18,918,751 (GRCm39) D67G Het
Eml5 A T 12: 98,825,099 (GRCm39) V706E probably damaging Het
Eps8l1 A G 7: 4,480,573 (GRCm39) D509G Het
Farsb T C 1: 78,459,951 (GRCm39) K43E probably benign Het
Fbxw20 A G 9: 109,052,514 (GRCm39) F273S probably damaging Het
Fig4 A T 10: 41,141,407 (GRCm39) F284Y possibly damaging Het
Fsd1l C A 4: 53,694,756 (GRCm39) N403K probably damaging Het
Fsip2 A T 2: 82,813,170 (GRCm39) H3163L probably benign Het
Gm38119 C A 3: 92,645,403 (GRCm39) G64* probably null Het
Gpr18 A G 14: 122,149,173 (GRCm39) V284A probably benign Het
Hacd3 A G 9: 64,908,286 (GRCm39) V170A probably damaging Het
Hps3 T C 3: 20,083,350 (GRCm39) E281G probably damaging Het
Ighv12-3 A C 12: 114,330,546 (GRCm39) V10G probably benign Het
Lrp1b G A 2: 40,589,590 (GRCm39) R3862* probably null Het
Ltbp4 A G 7: 27,036,976 (GRCm39) L6P unknown Het
Ly6h T A 15: 75,437,522 (GRCm39) T53S probably damaging Het
Ly6i A G 15: 74,855,006 (GRCm39) probably benign Het
Mat2a G A 6: 72,413,227 (GRCm39) R168C probably damaging Het
Mdn1 T A 4: 32,762,275 (GRCm39) D5066E possibly damaging Het
Med23 T A 10: 24,780,279 (GRCm39) F976I Het
Muc5ac T C 7: 141,363,529 (GRCm39) I2280T unknown Het
Mylk G T 16: 34,776,835 (GRCm39) C1336F probably benign Het
Myo9a G C 9: 59,768,772 (GRCm39) R918P probably damaging Het
Naglu T A 11: 100,967,731 (GRCm39) D560E probably damaging Het
Nrg2 C T 18: 36,157,396 (GRCm39) V430M probably damaging Het
Oit3 T C 10: 59,271,751 (GRCm39) N202S probably benign Het
Or13a1 A G 6: 116,470,881 (GRCm39) T104A probably benign Het
Or1e29 A T 11: 73,668,150 (GRCm39) M1K probably null Het
Or52r1 T C 7: 102,537,186 (GRCm39) H58R probably benign Het
Or5b101 T A 19: 13,005,360 (GRCm39) Y111F probably benign Het
Or6c63-ps1 C A 10: 128,899,097 (GRCm39) V260F probably damaging Het
Otog T A 7: 45,952,597 (GRCm39) C423* probably null Het
Pcolce T A 5: 137,603,770 (GRCm39) T401S probably benign Het
Pcsk2 T C 2: 143,655,583 (GRCm39) M589T possibly damaging Het
Pik3r5 T C 11: 68,383,099 (GRCm39) L306P possibly damaging Het
Pikfyve T A 1: 65,285,239 (GRCm39) M826K probably damaging Het
Prl7b1 A G 13: 27,790,968 (GRCm39) V39A probably benign Het
Pros1 T A 16: 62,748,397 (GRCm39) D623E probably damaging Het
Psg16 A G 7: 16,832,024 (GRCm39) D320G probably benign Het
Ptpre T A 7: 135,280,875 (GRCm39) H612Q probably damaging Het
Rbm34 A G 8: 127,679,928 (GRCm39) S283P probably damaging Het
Rc3h2 A T 2: 37,304,702 (GRCm39) N19K possibly damaging Het
Sacm1l T A 9: 123,381,827 (GRCm39) L143* probably null Het
Septin9 T A 11: 117,181,460 (GRCm39) S105T probably damaging Het
Shprh T C 10: 11,038,589 (GRCm39) M448T possibly damaging Het
Slc6a20a A C 9: 123,466,063 (GRCm39) *593E probably null Het
Smarcc1 A G 9: 109,964,710 (GRCm39) D89G possibly damaging Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Tanc2 T C 11: 105,689,603 (GRCm39) V255A probably benign Het
Tiam1 A G 16: 89,657,155 (GRCm39) S694P probably damaging Het
Tmem130 T C 5: 144,680,529 (GRCm39) T292A Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,105,203 (GRCm39) probably benign Het
Tpcn2 A G 7: 144,814,662 (GRCm39) Y480H probably damaging Het
Trf G T 9: 103,089,087 (GRCm39) A600D probably damaging Het
Ttc16 A T 2: 32,659,232 (GRCm39) L346Q probably damaging Het
Vars1 A C 17: 35,223,773 (GRCm39) K229N possibly damaging Het
Vmn1r113 G T 7: 20,521,342 (GRCm39) G45C probably damaging Het
Vmn1r32 A G 6: 66,530,020 (GRCm39) V252A probably benign Het
Vmn2r93 A G 17: 18,546,143 (GRCm39) T672A probably damaging Het
Wdfy4 T A 14: 32,819,807 (GRCm39) T1466S Het
Zcwpw1 T C 5: 137,809,182 (GRCm39) Y317H probably damaging Het
Zfp169 T C 13: 48,644,557 (GRCm39) E190G unknown Het
Zfp273 A T 13: 67,973,685 (GRCm39) H271L probably damaging Het
Zfp764 C A 7: 127,005,719 (GRCm39) E20* probably null Het
Znfx1 A T 2: 166,892,298 (GRCm39) N639K probably benign Het
Other mutations in Ppp1r9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ppp1r9a APN 6 5,158,195 (GRCm39) missense possibly damaging 0.72
IGL00796:Ppp1r9a APN 6 5,157,014 (GRCm39) missense probably benign 0.37
IGL00906:Ppp1r9a APN 6 5,157,023 (GRCm39) missense possibly damaging 0.62
IGL01662:Ppp1r9a APN 6 5,115,322 (GRCm39) missense probably damaging 1.00
IGL01695:Ppp1r9a APN 6 5,064,003 (GRCm39) missense probably damaging 1.00
IGL01807:Ppp1r9a APN 6 5,158,248 (GRCm39) nonsense probably null
IGL02126:Ppp1r9a APN 6 5,156,229 (GRCm39) missense probably damaging 1.00
IGL02423:Ppp1r9a APN 6 4,906,537 (GRCm39) missense probably benign 0.25
IGL03343:Ppp1r9a APN 6 5,046,015 (GRCm39) missense probably damaging 1.00
IGL03365:Ppp1r9a APN 6 5,110,993 (GRCm39) splice site probably benign
R0545:Ppp1r9a UTSW 6 5,115,357 (GRCm39) missense probably benign 0.45
R1126:Ppp1r9a UTSW 6 4,906,795 (GRCm39) missense possibly damaging 0.93
R1137:Ppp1r9a UTSW 6 5,159,697 (GRCm39) missense possibly damaging 0.46
R1443:Ppp1r9a UTSW 6 5,057,557 (GRCm39) missense probably damaging 1.00
R1484:Ppp1r9a UTSW 6 5,113,712 (GRCm39) nonsense probably null
R1545:Ppp1r9a UTSW 6 5,156,242 (GRCm39) critical splice donor site probably null
R1627:Ppp1r9a UTSW 6 4,906,168 (GRCm39) missense possibly damaging 0.50
R1672:Ppp1r9a UTSW 6 5,143,491 (GRCm39) critical splice donor site probably null
R1826:Ppp1r9a UTSW 6 5,111,060 (GRCm39) splice site probably benign
R1834:Ppp1r9a UTSW 6 5,113,710 (GRCm39) missense probably damaging 0.98
R1874:Ppp1r9a UTSW 6 4,906,348 (GRCm39) missense possibly damaging 0.87
R2224:Ppp1r9a UTSW 6 5,154,074 (GRCm39) missense probably benign
R2227:Ppp1r9a UTSW 6 5,154,074 (GRCm39) missense probably benign
R2898:Ppp1r9a UTSW 6 4,906,558 (GRCm39) missense probably benign 0.01
R3606:Ppp1r9a UTSW 6 5,113,674 (GRCm39) missense possibly damaging 0.90
R3732:Ppp1r9a UTSW 6 4,906,259 (GRCm39) unclassified probably benign
R3927:Ppp1r9a UTSW 6 5,057,531 (GRCm39) missense probably damaging 1.00
R4631:Ppp1r9a UTSW 6 4,906,537 (GRCm39) missense possibly damaging 0.62
R4682:Ppp1r9a UTSW 6 4,905,477 (GRCm39) missense possibly damaging 0.48
R4766:Ppp1r9a UTSW 6 5,157,016 (GRCm39) missense probably benign 0.11
R5197:Ppp1r9a UTSW 6 5,156,177 (GRCm39) missense probably damaging 1.00
R5217:Ppp1r9a UTSW 6 5,115,367 (GRCm39) missense probably damaging 1.00
R5493:Ppp1r9a UTSW 6 5,159,702 (GRCm39) missense probably damaging 0.99
R5790:Ppp1r9a UTSW 6 5,134,363 (GRCm39) intron probably benign
R5828:Ppp1r9a UTSW 6 5,158,200 (GRCm39) missense probably damaging 1.00
R5896:Ppp1r9a UTSW 6 5,159,648 (GRCm39) missense probably damaging 1.00
R5930:Ppp1r9a UTSW 6 5,157,002 (GRCm39) critical splice acceptor site probably null
R5990:Ppp1r9a UTSW 6 5,134,660 (GRCm39) missense probably benign 0.05
R6017:Ppp1r9a UTSW 6 4,906,363 (GRCm39) missense probably benign 0.18
R6122:Ppp1r9a UTSW 6 4,905,509 (GRCm39) missense probably damaging 1.00
R6164:Ppp1r9a UTSW 6 5,110,715 (GRCm39) intron probably benign
R6175:Ppp1r9a UTSW 6 4,905,639 (GRCm39) nonsense probably null
R6188:Ppp1r9a UTSW 6 5,158,113 (GRCm39) nonsense probably null
R6233:Ppp1r9a UTSW 6 5,077,610 (GRCm39) missense probably damaging 1.00
R6321:Ppp1r9a UTSW 6 5,115,151 (GRCm39) missense probably damaging 1.00
R6449:Ppp1r9a UTSW 6 5,057,458 (GRCm39) missense probably benign 0.44
R6454:Ppp1r9a UTSW 6 4,905,827 (GRCm39) missense probably damaging 1.00
R6527:Ppp1r9a UTSW 6 5,045,949 (GRCm39) missense probably damaging 1.00
R7053:Ppp1r9a UTSW 6 4,905,670 (GRCm39) missense probably damaging 1.00
R7233:Ppp1r9a UTSW 6 5,134,804 (GRCm39) missense probably benign
R7238:Ppp1r9a UTSW 6 5,159,716 (GRCm39) missense probably damaging 1.00
R7438:Ppp1r9a UTSW 6 5,115,378 (GRCm39) missense probably damaging 0.99
R7497:Ppp1r9a UTSW 6 4,905,775 (GRCm39) missense probably damaging 1.00
R7666:Ppp1r9a UTSW 6 5,143,238 (GRCm39) missense probably benign 0.00
R7698:Ppp1r9a UTSW 6 4,906,430 (GRCm39) missense probably benign
R7850:Ppp1r9a UTSW 6 4,905,894 (GRCm39) missense possibly damaging 0.77
R8029:Ppp1r9a UTSW 6 5,057,518 (GRCm39) missense possibly damaging 0.76
R8392:Ppp1r9a UTSW 6 5,143,491 (GRCm39) critical splice donor site probably null
R8411:Ppp1r9a UTSW 6 5,057,568 (GRCm39) missense probably damaging 1.00
R8431:Ppp1r9a UTSW 6 5,115,456 (GRCm39) missense probably benign 0.01
R8699:Ppp1r9a UTSW 6 5,115,474 (GRCm39) missense probably benign 0.00
R8708:Ppp1r9a UTSW 6 5,115,196 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r9a UTSW 6 5,134,657 (GRCm39) missense probably benign 0.00
R9096:Ppp1r9a UTSW 6 4,906,012 (GRCm39) missense probably damaging 1.00
R9097:Ppp1r9a UTSW 6 4,906,012 (GRCm39) missense probably damaging 1.00
R9279:Ppp1r9a UTSW 6 5,113,757 (GRCm39) missense probably damaging 1.00
R9512:Ppp1r9a UTSW 6 5,115,364 (GRCm39) missense probably damaging 0.99
R9512:Ppp1r9a UTSW 6 5,113,681 (GRCm39) missense probably benign 0.27
R9567:Ppp1r9a UTSW 6 5,157,004 (GRCm39) missense probably benign 0.34
R9672:Ppp1r9a UTSW 6 5,007,889 (GRCm39) missense unknown
R9687:Ppp1r9a UTSW 6 4,905,978 (GRCm39) missense probably damaging 1.00
R9715:Ppp1r9a UTSW 6 5,045,936 (GRCm39) missense probably damaging 0.96
RF007:Ppp1r9a UTSW 6 4,906,657 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGTGTTAGACAAGCTGG -3'
(R):5'- CTTCCAAGTAAGGCACAGATCAG -3'

Sequencing Primer
(F):5'- GGAAAAATTGGCTTCTGTCCC -3'
(R):5'- GATCAGTAAAACCGCTATCACGTTC -3'
Posted On 2022-01-20