Incidental Mutation 'R9131:Psg16'
ID 693623
Institutional Source Beutler Lab
Gene Symbol Psg16
Ensembl Gene ENSMUSG00000066760
Gene Name pregnancy specific beta-1-glycoprotein 16
Synonyms bCEA, Cea11
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 16807965-16867375 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16832024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 320 (D320G)
Ref Sequence ENSEMBL: ENSMUSP00000071348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071399] [ENSMUST00000118367] [ENSMUST00000152671]
AlphaFold Q8K0U8
Predicted Effect probably benign
Transcript: ENSMUST00000071399
AA Change: D320G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000071348
Gene: ENSMUSG00000066760
AA Change: D320G

DomainStartEndE-ValueType
IG_like 6 52 1.42e2 SMART
IG 71 172 1.21e-2 SMART
IG 191 292 2.56e-1 SMART
IG_like 302 395 5.13e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118367
AA Change: D320G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113025
Gene: ENSMUSG00000066760
AA Change: D320G

DomainStartEndE-ValueType
IG_like 6 52 1.42e2 SMART
IG 71 172 1.21e-2 SMART
IG 191 292 2.56e-1 SMART
IGc2 308 372 3.56e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152671
SMART Domains Protein: ENSMUSP00000118977
Gene: ENSMUSG00000066760

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
IG 46 143 4.29e-3 SMART
IG 162 261 2.94e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,160,075 (GRCm39) Y148F possibly damaging Het
Adamtsl3 A G 7: 82,244,722 (GRCm39) T1393A probably benign Het
Adgrf4 G T 17: 42,978,258 (GRCm39) Q362K probably benign Het
Akr1d1 A G 6: 37,531,451 (GRCm39) K163R probably benign Het
Arhgap42 A G 9: 9,011,364 (GRCm39) L474P probably damaging Het
Arhgef18 G A 8: 3,487,007 (GRCm39) R242Q possibly damaging Het
Asah1 A G 8: 41,807,049 (GRCm39) probably null Het
Atm A T 9: 53,445,044 (GRCm39) I34N probably benign Het
Brms1l A G 12: 55,906,913 (GRCm39) E160G possibly damaging Het
Camk2a C T 18: 61,076,327 (GRCm39) H102Y unknown Het
Cd300lb A G 11: 114,819,134 (GRCm39) V165A probably damaging Het
Cela1 G A 15: 100,579,038 (GRCm39) R207C probably benign Het
Chd7 T C 4: 8,785,642 (GRCm39) S649P Het
Cilk1 A T 9: 78,074,230 (GRCm39) S551C possibly damaging Het
Clic3 A G 2: 25,348,325 (GRCm39) Q130R probably benign Het
Clns1a G A 7: 97,363,125 (GRCm39) G166R probably damaging Het
Cngb1 A T 8: 95,979,893 (GRCm39) H1002Q probably benign Het
Cnnm1 C A 19: 43,429,839 (GRCm39) A319E probably benign Het
Cntnap5b C T 1: 99,978,368 (GRCm39) T128I probably benign Het
Csf3r G A 4: 125,923,813 (GRCm39) D108N probably benign Het
Ctsc G A 7: 87,959,016 (GRCm39) W432* probably null Het
Dapk1 G A 13: 60,909,208 (GRCm39) G1274R probably damaging Het
Dennd2c C A 3: 103,065,031 (GRCm39) P718Q probably damaging Het
Dmxl1 C G 18: 50,072,639 (GRCm39) N2744K probably damaging Het
Dnah7b C T 1: 46,266,180 (GRCm39) R2250C probably damaging Het
Dnmt3a A T 12: 3,916,136 (GRCm39) Q107L probably benign Het
Eml2 A G 7: 18,918,751 (GRCm39) D67G Het
Eml5 A T 12: 98,825,099 (GRCm39) V706E probably damaging Het
Eps8l1 A G 7: 4,480,573 (GRCm39) D509G Het
Farsb T C 1: 78,459,951 (GRCm39) K43E probably benign Het
Fbxw20 A G 9: 109,052,514 (GRCm39) F273S probably damaging Het
Fig4 A T 10: 41,141,407 (GRCm39) F284Y possibly damaging Het
Fsd1l C A 4: 53,694,756 (GRCm39) N403K probably damaging Het
Fsip2 A T 2: 82,813,170 (GRCm39) H3163L probably benign Het
Gm38119 C A 3: 92,645,403 (GRCm39) G64* probably null Het
Gpr18 A G 14: 122,149,173 (GRCm39) V284A probably benign Het
Hacd3 A G 9: 64,908,286 (GRCm39) V170A probably damaging Het
Hps3 T C 3: 20,083,350 (GRCm39) E281G probably damaging Het
Ighv12-3 A C 12: 114,330,546 (GRCm39) V10G probably benign Het
Lrp1b G A 2: 40,589,590 (GRCm39) R3862* probably null Het
Ltbp4 A G 7: 27,036,976 (GRCm39) L6P unknown Het
Ly6h T A 15: 75,437,522 (GRCm39) T53S probably damaging Het
Ly6i A G 15: 74,855,006 (GRCm39) probably benign Het
Mat2a G A 6: 72,413,227 (GRCm39) R168C probably damaging Het
Mdn1 T A 4: 32,762,275 (GRCm39) D5066E possibly damaging Het
Med23 T A 10: 24,780,279 (GRCm39) F976I Het
Muc5ac T C 7: 141,363,529 (GRCm39) I2280T unknown Het
Mylk G T 16: 34,776,835 (GRCm39) C1336F probably benign Het
Myo9a G C 9: 59,768,772 (GRCm39) R918P probably damaging Het
Naglu T A 11: 100,967,731 (GRCm39) D560E probably damaging Het
Nrg2 C T 18: 36,157,396 (GRCm39) V430M probably damaging Het
Oit3 T C 10: 59,271,751 (GRCm39) N202S probably benign Het
Or13a1 A G 6: 116,470,881 (GRCm39) T104A probably benign Het
Or1e29 A T 11: 73,668,150 (GRCm39) M1K probably null Het
Or52r1 T C 7: 102,537,186 (GRCm39) H58R probably benign Het
Or5b101 T A 19: 13,005,360 (GRCm39) Y111F probably benign Het
Or6c63-ps1 C A 10: 128,899,097 (GRCm39) V260F probably damaging Het
Otog T A 7: 45,952,597 (GRCm39) C423* probably null Het
Pcolce T A 5: 137,603,770 (GRCm39) T401S probably benign Het
Pcsk2 T C 2: 143,655,583 (GRCm39) M589T possibly damaging Het
Pik3r5 T C 11: 68,383,099 (GRCm39) L306P possibly damaging Het
Pikfyve T A 1: 65,285,239 (GRCm39) M826K probably damaging Het
Ppp1r9a A G 6: 5,134,106 (GRCm39) R898G possibly damaging Het
Prl7b1 A G 13: 27,790,968 (GRCm39) V39A probably benign Het
Pros1 T A 16: 62,748,397 (GRCm39) D623E probably damaging Het
Ptpre T A 7: 135,280,875 (GRCm39) H612Q probably damaging Het
Rbm34 A G 8: 127,679,928 (GRCm39) S283P probably damaging Het
Rc3h2 A T 2: 37,304,702 (GRCm39) N19K possibly damaging Het
Sacm1l T A 9: 123,381,827 (GRCm39) L143* probably null Het
Septin9 T A 11: 117,181,460 (GRCm39) S105T probably damaging Het
Shprh T C 10: 11,038,589 (GRCm39) M448T possibly damaging Het
Slc6a20a A C 9: 123,466,063 (GRCm39) *593E probably null Het
Smarcc1 A G 9: 109,964,710 (GRCm39) D89G possibly damaging Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Tanc2 T C 11: 105,689,603 (GRCm39) V255A probably benign Het
Tiam1 A G 16: 89,657,155 (GRCm39) S694P probably damaging Het
Tmem130 T C 5: 144,680,529 (GRCm39) T292A Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,105,203 (GRCm39) probably benign Het
Tpcn2 A G 7: 144,814,662 (GRCm39) Y480H probably damaging Het
Trf G T 9: 103,089,087 (GRCm39) A600D probably damaging Het
Ttc16 A T 2: 32,659,232 (GRCm39) L346Q probably damaging Het
Vars1 A C 17: 35,223,773 (GRCm39) K229N possibly damaging Het
Vmn1r113 G T 7: 20,521,342 (GRCm39) G45C probably damaging Het
Vmn1r32 A G 6: 66,530,020 (GRCm39) V252A probably benign Het
Vmn2r93 A G 17: 18,546,143 (GRCm39) T672A probably damaging Het
Wdfy4 T A 14: 32,819,807 (GRCm39) T1466S Het
Zcwpw1 T C 5: 137,809,182 (GRCm39) Y317H probably damaging Het
Zfp169 T C 13: 48,644,557 (GRCm39) E190G unknown Het
Zfp273 A T 13: 67,973,685 (GRCm39) H271L probably damaging Het
Zfp764 C A 7: 127,005,719 (GRCm39) E20* probably null Het
Znfx1 A T 2: 166,892,298 (GRCm39) N639K probably benign Het
Other mutations in Psg16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Psg16 APN 7 16,827,631 (GRCm39) missense probably benign 0.08
IGL02258:Psg16 APN 7 16,829,217 (GRCm39) missense probably damaging 1.00
R0379:Psg16 UTSW 7 16,864,583 (GRCm39) missense probably benign 0.09
R0389:Psg16 UTSW 7 16,829,088 (GRCm39) missense probably benign
R0443:Psg16 UTSW 7 16,829,088 (GRCm39) missense probably benign
R1231:Psg16 UTSW 7 16,829,230 (GRCm39) nonsense probably null
R1594:Psg16 UTSW 7 16,827,748 (GRCm39) missense probably damaging 1.00
R2064:Psg16 UTSW 7 16,827,673 (GRCm39) missense possibly damaging 0.91
R2118:Psg16 UTSW 7 16,824,548 (GRCm39) missense probably benign 0.33
R3806:Psg16 UTSW 7 16,824,609 (GRCm39) missense probably benign 0.24
R4397:Psg16 UTSW 7 16,824,623 (GRCm39) missense possibly damaging 0.68
R4583:Psg16 UTSW 7 16,829,097 (GRCm39) missense probably benign 0.01
R4685:Psg16 UTSW 7 16,824,459 (GRCm39) missense probably benign 0.00
R4929:Psg16 UTSW 7 16,829,031 (GRCm39) missense possibly damaging 0.79
R5310:Psg16 UTSW 7 16,824,560 (GRCm39) missense probably damaging 0.99
R6106:Psg16 UTSW 7 16,829,091 (GRCm39) missense possibly damaging 0.73
R6320:Psg16 UTSW 7 16,822,112 (GRCm39) missense probably damaging 1.00
R6702:Psg16 UTSW 7 16,824,321 (GRCm39) missense probably damaging 1.00
R6703:Psg16 UTSW 7 16,824,321 (GRCm39) missense probably damaging 1.00
R7329:Psg16 UTSW 7 16,824,611 (GRCm39) missense possibly damaging 0.86
R7679:Psg16 UTSW 7 16,827,685 (GRCm39) missense probably damaging 1.00
R8292:Psg16 UTSW 7 16,827,701 (GRCm39) missense probably damaging 0.99
R8372:Psg16 UTSW 7 16,829,240 (GRCm39) missense probably benign 0.10
R8491:Psg16 UTSW 7 16,824,437 (GRCm39) missense probably damaging 1.00
R8796:Psg16 UTSW 7 16,827,814 (GRCm39) missense possibly damaging 0.90
R9437:Psg16 UTSW 7 16,827,715 (GRCm39) missense probably damaging 1.00
R9659:Psg16 UTSW 7 16,824,524 (GRCm39) missense possibly damaging 0.55
R9746:Psg16 UTSW 7 16,832,086 (GRCm39) missense probably benign 0.02
R9788:Psg16 UTSW 7 16,824,524 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GACTGTAGTGACTGCTCCAATTTC -3'
(R):5'- GTCACTCATTCATCACGGCC -3'

Sequencing Primer
(F):5'- AATTTCTCCTCCCTGGAAGC -3'
(R):5'- ATTCATCACGGCCAGGCTG -3'
Posted On 2022-01-20