Incidental Mutation 'R9131:Asah1'
ID 693637
Institutional Source Beutler Lab
Gene Symbol Asah1
Ensembl Gene ENSMUSG00000031591
Gene Name N-acylsphingosine amidohydrolase 1
Synonyms 2310081N20Rik, acid ceramidase
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 41793234-41827810 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 41807049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034000] [ENSMUST00000110417] [ENSMUST00000143057]
AlphaFold Q9WV54
Predicted Effect probably null
Transcript: ENSMUST00000034000
SMART Domains Protein: ENSMUSP00000034000
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NAAA-beta 44 138 4.2e-35 PFAM
Pfam:CBAH 142 389 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110417
SMART Domains Protein: ENSMUSP00000106047
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
Pfam:NAAA-beta 24 118 8.8e-39 PFAM
Pfam:CBAH 122 216 7.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126561
Predicted Effect probably benign
Transcript: ENSMUST00000143057
SMART Domains Protein: ENSMUSP00000117362
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:NAAA-beta 68 120 6.4e-18 PFAM
Meta Mutation Damage Score 0.9593 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes acid ceramidase, an enzyme that plays a central role in ceramide metabolism. The encoded protein undergoes proteolytic processing to generate a heterodimeric enzyme comprised of alpha and beta subunits that catalyzes the hydrolysis of sphingolipid ceramide into sphingosine and free fatty acid. The homozygous disruption of this gene leads to embryonic lethality in mice whereas the heterozygous animals exhibit a progressive lipid storage disease phenotype. [provided by RefSeq, Oct 2015]
PHENOTYPE: Nullizygous mutation of this gene causes embryonic lethality. Homozygotes for the P361R mutation die prematurely with growth defects, low acid ceramidase activity, high ceramide levels, histiocyte infiltrates into various organs, Farber bodies, short femur growth plates and altered ovary morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,160,075 (GRCm39) Y148F possibly damaging Het
Adamtsl3 A G 7: 82,244,722 (GRCm39) T1393A probably benign Het
Adgrf4 G T 17: 42,978,258 (GRCm39) Q362K probably benign Het
Akr1d1 A G 6: 37,531,451 (GRCm39) K163R probably benign Het
Arhgap42 A G 9: 9,011,364 (GRCm39) L474P probably damaging Het
Arhgef18 G A 8: 3,487,007 (GRCm39) R242Q possibly damaging Het
Atm A T 9: 53,445,044 (GRCm39) I34N probably benign Het
Brms1l A G 12: 55,906,913 (GRCm39) E160G possibly damaging Het
Camk2a C T 18: 61,076,327 (GRCm39) H102Y unknown Het
Cd300lb A G 11: 114,819,134 (GRCm39) V165A probably damaging Het
Cela1 G A 15: 100,579,038 (GRCm39) R207C probably benign Het
Chd7 T C 4: 8,785,642 (GRCm39) S649P Het
Cilk1 A T 9: 78,074,230 (GRCm39) S551C possibly damaging Het
Clic3 A G 2: 25,348,325 (GRCm39) Q130R probably benign Het
Clns1a G A 7: 97,363,125 (GRCm39) G166R probably damaging Het
Cngb1 A T 8: 95,979,893 (GRCm39) H1002Q probably benign Het
Cnnm1 C A 19: 43,429,839 (GRCm39) A319E probably benign Het
Cntnap5b C T 1: 99,978,368 (GRCm39) T128I probably benign Het
Csf3r G A 4: 125,923,813 (GRCm39) D108N probably benign Het
Ctsc G A 7: 87,959,016 (GRCm39) W432* probably null Het
Dapk1 G A 13: 60,909,208 (GRCm39) G1274R probably damaging Het
Dennd2c C A 3: 103,065,031 (GRCm39) P718Q probably damaging Het
Dmxl1 C G 18: 50,072,639 (GRCm39) N2744K probably damaging Het
Dnah7b C T 1: 46,266,180 (GRCm39) R2250C probably damaging Het
Dnmt3a A T 12: 3,916,136 (GRCm39) Q107L probably benign Het
Eml2 A G 7: 18,918,751 (GRCm39) D67G Het
Eml5 A T 12: 98,825,099 (GRCm39) V706E probably damaging Het
Eps8l1 A G 7: 4,480,573 (GRCm39) D509G Het
Farsb T C 1: 78,459,951 (GRCm39) K43E probably benign Het
Fbxw20 A G 9: 109,052,514 (GRCm39) F273S probably damaging Het
Fig4 A T 10: 41,141,407 (GRCm39) F284Y possibly damaging Het
Fsd1l C A 4: 53,694,756 (GRCm39) N403K probably damaging Het
Fsip2 A T 2: 82,813,170 (GRCm39) H3163L probably benign Het
Gm38119 C A 3: 92,645,403 (GRCm39) G64* probably null Het
Gpr18 A G 14: 122,149,173 (GRCm39) V284A probably benign Het
Hacd3 A G 9: 64,908,286 (GRCm39) V170A probably damaging Het
Hps3 T C 3: 20,083,350 (GRCm39) E281G probably damaging Het
Ighv12-3 A C 12: 114,330,546 (GRCm39) V10G probably benign Het
Lrp1b G A 2: 40,589,590 (GRCm39) R3862* probably null Het
Ltbp4 A G 7: 27,036,976 (GRCm39) L6P unknown Het
Ly6h T A 15: 75,437,522 (GRCm39) T53S probably damaging Het
Ly6i A G 15: 74,855,006 (GRCm39) probably benign Het
Mat2a G A 6: 72,413,227 (GRCm39) R168C probably damaging Het
Mdn1 T A 4: 32,762,275 (GRCm39) D5066E possibly damaging Het
Med23 T A 10: 24,780,279 (GRCm39) F976I Het
Muc5ac T C 7: 141,363,529 (GRCm39) I2280T unknown Het
Mylk G T 16: 34,776,835 (GRCm39) C1336F probably benign Het
Myo9a G C 9: 59,768,772 (GRCm39) R918P probably damaging Het
Naglu T A 11: 100,967,731 (GRCm39) D560E probably damaging Het
Nrg2 C T 18: 36,157,396 (GRCm39) V430M probably damaging Het
Oit3 T C 10: 59,271,751 (GRCm39) N202S probably benign Het
Or13a1 A G 6: 116,470,881 (GRCm39) T104A probably benign Het
Or1e29 A T 11: 73,668,150 (GRCm39) M1K probably null Het
Or52r1 T C 7: 102,537,186 (GRCm39) H58R probably benign Het
Or5b101 T A 19: 13,005,360 (GRCm39) Y111F probably benign Het
Or6c63-ps1 C A 10: 128,899,097 (GRCm39) V260F probably damaging Het
Otog T A 7: 45,952,597 (GRCm39) C423* probably null Het
Pcolce T A 5: 137,603,770 (GRCm39) T401S probably benign Het
Pcsk2 T C 2: 143,655,583 (GRCm39) M589T possibly damaging Het
Pik3r5 T C 11: 68,383,099 (GRCm39) L306P possibly damaging Het
Pikfyve T A 1: 65,285,239 (GRCm39) M826K probably damaging Het
Ppp1r9a A G 6: 5,134,106 (GRCm39) R898G possibly damaging Het
Prl7b1 A G 13: 27,790,968 (GRCm39) V39A probably benign Het
Pros1 T A 16: 62,748,397 (GRCm39) D623E probably damaging Het
Psg16 A G 7: 16,832,024 (GRCm39) D320G probably benign Het
Ptpre T A 7: 135,280,875 (GRCm39) H612Q probably damaging Het
Rbm34 A G 8: 127,679,928 (GRCm39) S283P probably damaging Het
Rc3h2 A T 2: 37,304,702 (GRCm39) N19K possibly damaging Het
Sacm1l T A 9: 123,381,827 (GRCm39) L143* probably null Het
Septin9 T A 11: 117,181,460 (GRCm39) S105T probably damaging Het
Shprh T C 10: 11,038,589 (GRCm39) M448T possibly damaging Het
Slc6a20a A C 9: 123,466,063 (GRCm39) *593E probably null Het
Smarcc1 A G 9: 109,964,710 (GRCm39) D89G possibly damaging Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Tanc2 T C 11: 105,689,603 (GRCm39) V255A probably benign Het
Tiam1 A G 16: 89,657,155 (GRCm39) S694P probably damaging Het
Tmem130 T C 5: 144,680,529 (GRCm39) T292A Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,105,203 (GRCm39) probably benign Het
Tpcn2 A G 7: 144,814,662 (GRCm39) Y480H probably damaging Het
Trf G T 9: 103,089,087 (GRCm39) A600D probably damaging Het
Ttc16 A T 2: 32,659,232 (GRCm39) L346Q probably damaging Het
Vars1 A C 17: 35,223,773 (GRCm39) K229N possibly damaging Het
Vmn1r113 G T 7: 20,521,342 (GRCm39) G45C probably damaging Het
Vmn1r32 A G 6: 66,530,020 (GRCm39) V252A probably benign Het
Vmn2r93 A G 17: 18,546,143 (GRCm39) T672A probably damaging Het
Wdfy4 T A 14: 32,819,807 (GRCm39) T1466S Het
Zcwpw1 T C 5: 137,809,182 (GRCm39) Y317H probably damaging Het
Zfp169 T C 13: 48,644,557 (GRCm39) E190G unknown Het
Zfp273 A T 13: 67,973,685 (GRCm39) H271L probably damaging Het
Zfp764 C A 7: 127,005,719 (GRCm39) E20* probably null Het
Znfx1 A T 2: 166,892,298 (GRCm39) N639K probably benign Het
Other mutations in Asah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Asah1 APN 8 41,802,580 (GRCm39) unclassified probably benign
IGL02512:Asah1 APN 8 41,813,344 (GRCm39) intron probably benign
IGL02523:Asah1 APN 8 41,804,984 (GRCm39) missense probably benign
IGL03115:Asah1 APN 8 41,813,336 (GRCm39) missense possibly damaging 0.94
IGL03357:Asah1 APN 8 41,799,233 (GRCm39) splice site probably benign
PIT4366001:Asah1 UTSW 8 41,796,783 (GRCm39) missense possibly damaging 0.94
R0593:Asah1 UTSW 8 41,802,619 (GRCm39) missense probably benign 0.02
R1451:Asah1 UTSW 8 41,807,049 (GRCm39) critical splice donor site probably null
R1977:Asah1 UTSW 8 41,796,554 (GRCm39) critical splice donor site probably null
R2200:Asah1 UTSW 8 41,796,765 (GRCm39) critical splice donor site probably null
R3429:Asah1 UTSW 8 41,804,925 (GRCm39) unclassified probably benign
R4002:Asah1 UTSW 8 41,801,176 (GRCm39) splice site probably benign
R4078:Asah1 UTSW 8 41,807,119 (GRCm39) missense probably damaging 0.99
R4470:Asah1 UTSW 8 41,796,761 (GRCm39) splice site probably null
R4471:Asah1 UTSW 8 41,796,761 (GRCm39) splice site probably null
R4968:Asah1 UTSW 8 41,807,067 (GRCm39) missense
R4970:Asah1 UTSW 8 41,813,314 (GRCm39) nonsense probably null
R5643:Asah1 UTSW 8 41,813,332 (GRCm39) missense possibly damaging 0.94
R5644:Asah1 UTSW 8 41,813,332 (GRCm39) missense possibly damaging 0.94
R6128:Asah1 UTSW 8 41,807,092 (GRCm39) missense probably damaging 1.00
R6419:Asah1 UTSW 8 41,796,803 (GRCm39) missense probably damaging 1.00
R7059:Asah1 UTSW 8 41,800,106 (GRCm39) missense probably damaging 0.96
R7442:Asah1 UTSW 8 41,796,602 (GRCm39) missense possibly damaging 0.60
R7587:Asah1 UTSW 8 41,827,578 (GRCm39) missense probably benign 0.43
R7663:Asah1 UTSW 8 41,794,664 (GRCm39) missense probably damaging 0.98
R7980:Asah1 UTSW 8 41,807,067 (GRCm39) missense
R8122:Asah1 UTSW 8 41,796,767 (GRCm39) missense probably benign 0.01
R8275:Asah1 UTSW 8 41,801,159 (GRCm39) missense probably damaging 1.00
R8700:Asah1 UTSW 8 41,813,312 (GRCm39) missense probably benign 0.03
R8752:Asah1 UTSW 8 41,813,314 (GRCm39) missense possibly damaging 0.47
R8960:Asah1 UTSW 8 41,800,061 (GRCm39) missense probably damaging 1.00
R9539:Asah1 UTSW 8 41,827,584 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGCTCAAAATTTCATGCTCCTG -3'
(R):5'- CTGAATGATTGAGAAGCAATGCTAC -3'

Sequencing Primer
(F):5'- TCATGCTCCTGATGAAATTTGTG -3'
(R):5'- GATTGAGAAGCAATGCTACTTTAAAG -3'
Posted On 2022-01-20