Incidental Mutation 'R9131:Med23'
ID 693651
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24869986-24913681 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24904381 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 976 (F976I)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020159
AA Change: F970I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: F970I

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: F976I

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176285
AA Change: F610I

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: F610I

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,508 Y148F possibly damaging Het
Adamtsl3 A G 7: 82,595,514 T1393A probably benign Het
Adgrf4 G T 17: 42,667,367 Q362K probably benign Het
Akr1d1 A G 6: 37,554,516 K163R probably benign Het
Arhgap42 A G 9: 9,011,363 L474P probably damaging Het
Arhgef18 G A 8: 3,437,007 R242Q possibly damaging Het
Asah1 A G 8: 41,354,012 probably null Het
Atm A T 9: 53,533,744 I34N probably benign Het
Brms1l A G 12: 55,860,128 E160G possibly damaging Het
Camk2a C T 18: 60,943,255 H102Y unknown Het
Cd300lb A G 11: 114,928,308 V165A probably damaging Het
Cela1 G A 15: 100,681,157 R207C probably benign Het
Chd7 T C 4: 8,785,642 S649P Het
Clic3 A G 2: 25,458,313 Q130R probably benign Het
Clns1a G A 7: 97,713,918 G166R probably damaging Het
Cngb1 A T 8: 95,253,265 H1002Q probably benign Het
Cnnm1 C A 19: 43,441,400 A319E probably benign Het
Cntnap5b C T 1: 100,050,643 T128I probably benign Het
Csf3r G A 4: 126,030,020 D108N probably benign Het
Ctsc G A 7: 88,309,808 W432* probably null Het
Dapk1 G A 13: 60,761,394 G1274R probably damaging Het
Dennd2c C A 3: 103,157,715 P718Q probably damaging Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah7b C T 1: 46,227,020 R2250C probably damaging Het
Dnmt3a A T 12: 3,866,136 Q107L probably benign Het
Eml2 A G 7: 19,184,826 D67G Het
Eml5 A T 12: 98,858,840 V706E probably damaging Het
Eps8l1 A G 7: 4,477,574 D509G Het
Farsb T C 1: 78,483,314 K43E probably benign Het
Fbxw20 A G 9: 109,223,446 F273S probably damaging Het
Fig4 A T 10: 41,265,411 F284Y possibly damaging Het
Fsd1l C A 4: 53,694,756 N403K probably damaging Het
Fsip2 A T 2: 82,982,826 H3163L probably benign Het
Gm38119 C A 3: 92,738,096 G64* probably null Het
Gpr18 A G 14: 121,911,761 V284A probably benign Het
Hacd3 A G 9: 65,001,004 V170A probably damaging Het
Hps3 T C 3: 20,029,186 E281G probably damaging Het
Ick A T 9: 78,166,948 S551C possibly damaging Het
Ighv12-3 A C 12: 114,366,926 V10G probably benign Het
Lrp1b G A 2: 40,699,578 R3862* probably null Het
Ltbp4 A G 7: 27,337,551 L6P unknown Het
Ly6h T A 15: 75,565,673 T53S probably damaging Het
Ly6i A G 15: 74,983,157 probably benign Het
Mat2a G A 6: 72,436,244 R168C probably damaging Het
Mdn1 T A 4: 32,762,275 D5066E possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Mylk G T 16: 34,956,465 C1336F probably benign Het
Myo9a G C 9: 59,861,489 R918P probably damaging Het
Naglu T A 11: 101,076,905 D560E probably damaging Het
Nrg2 C T 18: 36,024,343 V430M probably damaging Het
Oit3 T C 10: 59,435,929 N202S probably benign Het
Olfr1453 T A 19: 13,027,996 Y111F probably benign Het
Olfr211 A G 6: 116,493,920 T104A probably benign Het
Olfr389 A T 11: 73,777,324 M1K probably null Het
Olfr569 T C 7: 102,887,979 H58R probably benign Het
Olfr766-ps1 C A 10: 129,063,228 V260F probably damaging Het
Otog T A 7: 46,303,173 C423* probably null Het
Pcolce T A 5: 137,605,508 T401S probably benign Het
Pcsk2 T C 2: 143,813,663 M589T possibly damaging Het
Pik3r5 T C 11: 68,492,273 L306P possibly damaging Het
Pikfyve T A 1: 65,246,080 M826K probably damaging Het
Ppp1r9a A G 6: 5,134,106 R898G possibly damaging Het
Prl7b1 A G 13: 27,606,985 V39A probably benign Het
Pros1 T A 16: 62,928,034 D623E probably damaging Het
Psg16 A G 7: 17,098,099 D320G probably benign Het
Ptpre T A 7: 135,679,146 H612Q probably damaging Het
Rbm34 A G 8: 126,953,178 S283P probably damaging Het
Rc3h2 A T 2: 37,414,690 N19K possibly damaging Het
Sacm1l T A 9: 123,552,762 L143* probably null Het
Sept9 T A 11: 117,290,634 S105T probably damaging Het
Shprh T C 10: 11,162,845 M448T possibly damaging Het
Slc6a20a A C 9: 123,636,998 *593E probably null Het
Smarcc1 A G 9: 110,135,642 D89G possibly damaging Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Tanc2 T C 11: 105,798,777 V255A probably benign Het
Tiam1 A G 16: 89,860,267 S694P probably damaging Het
Tmem130 T C 5: 144,743,719 T292A Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,214,377 probably benign Het
Tpcn2 A G 7: 145,260,925 Y480H probably damaging Het
Trf G T 9: 103,211,888 A600D probably damaging Het
Ttc16 A T 2: 32,769,220 L346Q probably damaging Het
Vars A C 17: 35,004,797 K229N possibly damaging Het
Vmn1r113 G T 7: 20,787,417 G45C probably damaging Het
Vmn1r32 A G 6: 66,553,036 V252A probably benign Het
Vmn2r93 A G 17: 18,325,881 T672A probably damaging Het
Wdfy4 T A 14: 33,097,850 T1466S Het
Zcwpw1 T C 5: 137,810,920 Y317H probably damaging Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp273 A T 13: 67,825,566 H271L probably damaging Het
Zfp764 C A 7: 127,406,547 E20* probably null Het
Znfx1 A T 2: 167,050,378 N639K probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
R8975:Med23 UTSW 10 24904436 missense probably benign 0.42
R9202:Med23 UTSW 10 24904304 missense probably benign 0.12
R9341:Med23 UTSW 10 24912807 missense probably benign
R9342:Med23 UTSW 10 24874571 missense probably benign 0.01
R9343:Med23 UTSW 10 24912807 missense probably benign
R9412:Med23 UTSW 10 24902121 missense probably damaging 1.00
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATTTAAGGAGGCATGTGC -3'
(R):5'- TTACTACATGGCGTGCTCAGC -3'

Sequencing Primer
(F):5'- GTAGCTCTTTTGTGCTCGC -3'
(R):5'- GTGCTCAGCCTATCTGTTCATAAAGG -3'
Posted On 2022-01-20