Incidental Mutation 'R9131:Med23'
ID 693651
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms ESTM7, 3000002A17Rik, X83317, Sur2, Crsp3, sno
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24745889-24789358 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24780279 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 976 (F976I)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020159
AA Change: F970I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: F970I

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: F976I

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176285
AA Change: F610I

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: F610I

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,160,075 (GRCm39) Y148F possibly damaging Het
Adamtsl3 A G 7: 82,244,722 (GRCm39) T1393A probably benign Het
Adgrf4 G T 17: 42,978,258 (GRCm39) Q362K probably benign Het
Akr1d1 A G 6: 37,531,451 (GRCm39) K163R probably benign Het
Arhgap42 A G 9: 9,011,364 (GRCm39) L474P probably damaging Het
Arhgef18 G A 8: 3,487,007 (GRCm39) R242Q possibly damaging Het
Asah1 A G 8: 41,807,049 (GRCm39) probably null Het
Atm A T 9: 53,445,044 (GRCm39) I34N probably benign Het
Brms1l A G 12: 55,906,913 (GRCm39) E160G possibly damaging Het
Camk2a C T 18: 61,076,327 (GRCm39) H102Y unknown Het
Cd300lb A G 11: 114,819,134 (GRCm39) V165A probably damaging Het
Cela1 G A 15: 100,579,038 (GRCm39) R207C probably benign Het
Chd7 T C 4: 8,785,642 (GRCm39) S649P Het
Cilk1 A T 9: 78,074,230 (GRCm39) S551C possibly damaging Het
Clic3 A G 2: 25,348,325 (GRCm39) Q130R probably benign Het
Clns1a G A 7: 97,363,125 (GRCm39) G166R probably damaging Het
Cngb1 A T 8: 95,979,893 (GRCm39) H1002Q probably benign Het
Cnnm1 C A 19: 43,429,839 (GRCm39) A319E probably benign Het
Cntnap5b C T 1: 99,978,368 (GRCm39) T128I probably benign Het
Csf3r G A 4: 125,923,813 (GRCm39) D108N probably benign Het
Ctsc G A 7: 87,959,016 (GRCm39) W432* probably null Het
Dapk1 G A 13: 60,909,208 (GRCm39) G1274R probably damaging Het
Dennd2c C A 3: 103,065,031 (GRCm39) P718Q probably damaging Het
Dmxl1 C G 18: 50,072,639 (GRCm39) N2744K probably damaging Het
Dnah7b C T 1: 46,266,180 (GRCm39) R2250C probably damaging Het
Dnmt3a A T 12: 3,916,136 (GRCm39) Q107L probably benign Het
Eml2 A G 7: 18,918,751 (GRCm39) D67G Het
Eml5 A T 12: 98,825,099 (GRCm39) V706E probably damaging Het
Eps8l1 A G 7: 4,480,573 (GRCm39) D509G Het
Farsb T C 1: 78,459,951 (GRCm39) K43E probably benign Het
Fbxw20 A G 9: 109,052,514 (GRCm39) F273S probably damaging Het
Fig4 A T 10: 41,141,407 (GRCm39) F284Y possibly damaging Het
Fsd1l C A 4: 53,694,756 (GRCm39) N403K probably damaging Het
Fsip2 A T 2: 82,813,170 (GRCm39) H3163L probably benign Het
Gm38119 C A 3: 92,645,403 (GRCm39) G64* probably null Het
Gpr18 A G 14: 122,149,173 (GRCm39) V284A probably benign Het
Hacd3 A G 9: 64,908,286 (GRCm39) V170A probably damaging Het
Hps3 T C 3: 20,083,350 (GRCm39) E281G probably damaging Het
Ighv12-3 A C 12: 114,330,546 (GRCm39) V10G probably benign Het
Lrp1b G A 2: 40,589,590 (GRCm39) R3862* probably null Het
Ltbp4 A G 7: 27,036,976 (GRCm39) L6P unknown Het
Ly6h T A 15: 75,437,522 (GRCm39) T53S probably damaging Het
Ly6i A G 15: 74,855,006 (GRCm39) probably benign Het
Mat2a G A 6: 72,413,227 (GRCm39) R168C probably damaging Het
Mdn1 T A 4: 32,762,275 (GRCm39) D5066E possibly damaging Het
Muc5ac T C 7: 141,363,529 (GRCm39) I2280T unknown Het
Mylk G T 16: 34,776,835 (GRCm39) C1336F probably benign Het
Myo9a G C 9: 59,768,772 (GRCm39) R918P probably damaging Het
Naglu T A 11: 100,967,731 (GRCm39) D560E probably damaging Het
Nrg2 C T 18: 36,157,396 (GRCm39) V430M probably damaging Het
Oit3 T C 10: 59,271,751 (GRCm39) N202S probably benign Het
Or13a1 A G 6: 116,470,881 (GRCm39) T104A probably benign Het
Or1e29 A T 11: 73,668,150 (GRCm39) M1K probably null Het
Or52r1 T C 7: 102,537,186 (GRCm39) H58R probably benign Het
Or5b101 T A 19: 13,005,360 (GRCm39) Y111F probably benign Het
Or6c63-ps1 C A 10: 128,899,097 (GRCm39) V260F probably damaging Het
Otog T A 7: 45,952,597 (GRCm39) C423* probably null Het
Pcolce T A 5: 137,603,770 (GRCm39) T401S probably benign Het
Pcsk2 T C 2: 143,655,583 (GRCm39) M589T possibly damaging Het
Pik3r5 T C 11: 68,383,099 (GRCm39) L306P possibly damaging Het
Pikfyve T A 1: 65,285,239 (GRCm39) M826K probably damaging Het
Ppp1r9a A G 6: 5,134,106 (GRCm39) R898G possibly damaging Het
Prl7b1 A G 13: 27,790,968 (GRCm39) V39A probably benign Het
Pros1 T A 16: 62,748,397 (GRCm39) D623E probably damaging Het
Psg16 A G 7: 16,832,024 (GRCm39) D320G probably benign Het
Ptpre T A 7: 135,280,875 (GRCm39) H612Q probably damaging Het
Rbm34 A G 8: 127,679,928 (GRCm39) S283P probably damaging Het
Rc3h2 A T 2: 37,304,702 (GRCm39) N19K possibly damaging Het
Sacm1l T A 9: 123,381,827 (GRCm39) L143* probably null Het
Septin9 T A 11: 117,181,460 (GRCm39) S105T probably damaging Het
Shprh T C 10: 11,038,589 (GRCm39) M448T possibly damaging Het
Slc6a20a A C 9: 123,466,063 (GRCm39) *593E probably null Het
Smarcc1 A G 9: 109,964,710 (GRCm39) D89G possibly damaging Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Tanc2 T C 11: 105,689,603 (GRCm39) V255A probably benign Het
Tiam1 A G 16: 89,657,155 (GRCm39) S694P probably damaging Het
Tmem130 T C 5: 144,680,529 (GRCm39) T292A Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,105,203 (GRCm39) probably benign Het
Tpcn2 A G 7: 144,814,662 (GRCm39) Y480H probably damaging Het
Trf G T 9: 103,089,087 (GRCm39) A600D probably damaging Het
Ttc16 A T 2: 32,659,232 (GRCm39) L346Q probably damaging Het
Vars1 A C 17: 35,223,773 (GRCm39) K229N possibly damaging Het
Vmn1r113 G T 7: 20,521,342 (GRCm39) G45C probably damaging Het
Vmn1r32 A G 6: 66,530,020 (GRCm39) V252A probably benign Het
Vmn2r93 A G 17: 18,546,143 (GRCm39) T672A probably damaging Het
Wdfy4 T A 14: 32,819,807 (GRCm39) T1466S Het
Zcwpw1 T C 5: 137,809,182 (GRCm39) Y317H probably damaging Het
Zfp169 T C 13: 48,644,557 (GRCm39) E190G unknown Het
Zfp273 A T 13: 67,973,685 (GRCm39) H271L probably damaging Het
Zfp764 C A 7: 127,005,719 (GRCm39) E20* probably null Het
Znfx1 A T 2: 166,892,298 (GRCm39) N639K probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24,764,482 (GRCm39) missense probably damaging 1.00
IGL00792:Med23 APN 10 24,752,902 (GRCm39) missense possibly damaging 0.93
IGL01289:Med23 APN 10 24,778,019 (GRCm39) missense probably damaging 1.00
IGL01469:Med23 APN 10 24,758,495 (GRCm39) missense probably damaging 1.00
IGL01598:Med23 APN 10 24,779,696 (GRCm39) missense probably benign 0.34
IGL02324:Med23 APN 10 24,773,239 (GRCm39) missense probably damaging 0.98
IGL02381:Med23 APN 10 24,776,626 (GRCm39) missense possibly damaging 0.95
IGL02465:Med23 APN 10 24,779,641 (GRCm39) missense probably damaging 0.96
IGL02554:Med23 APN 10 24,774,473 (GRCm39) critical splice donor site probably null
IGL02683:Med23 APN 10 24,746,615 (GRCm39) missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R0080:Med23 UTSW 10 24,788,715 (GRCm39) missense probably benign 0.33
R0125:Med23 UTSW 10 24,776,686 (GRCm39) missense probably damaging 1.00
R0311:Med23 UTSW 10 24,773,256 (GRCm39) missense possibly damaging 0.95
R0765:Med23 UTSW 10 24,776,608 (GRCm39) missense probably damaging 1.00
R1302:Med23 UTSW 10 24,764,320 (GRCm39) splice site probably null
R1456:Med23 UTSW 10 24,779,550 (GRCm39) splice site probably benign
R1514:Med23 UTSW 10 24,768,565 (GRCm39) splice site probably benign
R1774:Med23 UTSW 10 24,779,584 (GRCm39) missense probably damaging 1.00
R1851:Med23 UTSW 10 24,786,768 (GRCm39) splice site probably null
R1928:Med23 UTSW 10 24,785,710 (GRCm39) missense probably benign
R1975:Med23 UTSW 10 24,786,664 (GRCm39) missense probably benign 0.01
R2011:Med23 UTSW 10 24,755,653 (GRCm39) missense possibly damaging 0.63
R2266:Med23 UTSW 10 24,750,499 (GRCm39) missense probably benign 0.00
R2309:Med23 UTSW 10 24,746,586 (GRCm39) missense probably damaging 0.99
R2507:Med23 UTSW 10 24,786,711 (GRCm39) missense probably damaging 1.00
R2566:Med23 UTSW 10 24,764,473 (GRCm39) missense probably damaging 1.00
R3720:Med23 UTSW 10 24,767,018 (GRCm39) missense probably damaging 1.00
R3771:Med23 UTSW 10 24,778,099 (GRCm39) missense probably damaging 1.00
R3811:Med23 UTSW 10 24,768,491 (GRCm39) splice site probably null
R3811:Med23 UTSW 10 24,768,490 (GRCm39) nonsense probably null
R4305:Med23 UTSW 10 24,780,168 (GRCm39) nonsense probably null
R4323:Med23 UTSW 10 24,746,603 (GRCm39) missense probably benign 0.02
R4701:Med23 UTSW 10 24,769,546 (GRCm39) missense probably damaging 1.00
R4886:Med23 UTSW 10 24,750,581 (GRCm39) critical splice donor site probably null
R4925:Med23 UTSW 10 24,786,645 (GRCm39) missense probably damaging 1.00
R4943:Med23 UTSW 10 24,751,567 (GRCm39) missense possibly damaging 0.92
R5207:Med23 UTSW 10 24,771,734 (GRCm39) nonsense probably null
R5749:Med23 UTSW 10 24,764,347 (GRCm39) missense possibly damaging 0.84
R5806:Med23 UTSW 10 24,783,119 (GRCm39) missense probably damaging 1.00
R5896:Med23 UTSW 10 24,778,043 (GRCm39) missense probably damaging 1.00
R5954:Med23 UTSW 10 24,746,381 (GRCm39) splice site probably benign
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6093:Med23 UTSW 10 24,754,341 (GRCm39) missense probably benign 0.16
R6107:Med23 UTSW 10 24,781,932 (GRCm39) nonsense probably null
R6356:Med23 UTSW 10 24,764,311 (GRCm39) missense probably damaging 0.98
R6393:Med23 UTSW 10 24,749,374 (GRCm39) missense possibly damaging 0.91
R6533:Med23 UTSW 10 24,769,518 (GRCm39) missense probably damaging 1.00
R6911:Med23 UTSW 10 24,778,079 (GRCm39) missense probably damaging 0.98
R6981:Med23 UTSW 10 24,771,722 (GRCm39) missense possibly damaging 0.92
R7085:Med23 UTSW 10 24,746,019 (GRCm39) missense probably damaging 1.00
R7215:Med23 UTSW 10 24,764,327 (GRCm39) missense probably benign
R7229:Med23 UTSW 10 24,777,902 (GRCm39) missense probably benign
R7489:Med23 UTSW 10 24,780,254 (GRCm39) missense probably damaging 1.00
R7530:Med23 UTSW 10 24,781,851 (GRCm39) missense probably benign 0.00
R7643:Med23 UTSW 10 24,781,863 (GRCm39) missense probably benign 0.01
R7653:Med23 UTSW 10 24,780,282 (GRCm39) missense probably damaging 1.00
R7764:Med23 UTSW 10 24,785,818 (GRCm39) critical splice donor site probably null
R7784:Med23 UTSW 10 24,778,346 (GRCm39) missense probably damaging 1.00
R8024:Med23 UTSW 10 24,755,581 (GRCm39) missense possibly damaging 0.74
R8182:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R8412:Med23 UTSW 10 24,784,632 (GRCm39) missense probably benign 0.01
R8874:Med23 UTSW 10 24,771,617 (GRCm39) missense possibly damaging 0.92
R8975:Med23 UTSW 10 24,780,334 (GRCm39) missense probably benign 0.42
R9202:Med23 UTSW 10 24,780,202 (GRCm39) missense probably benign 0.12
R9341:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9342:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R9343:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9412:Med23 UTSW 10 24,778,019 (GRCm39) missense probably damaging 1.00
RF003:Med23 UTSW 10 24,779,683 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATTTAAGGAGGCATGTGC -3'
(R):5'- TTACTACATGGCGTGCTCAGC -3'

Sequencing Primer
(F):5'- GTAGCTCTTTTGTGCTCGC -3'
(R):5'- GTGCTCAGCCTATCTGTTCATAAAGG -3'
Posted On 2022-01-20