Incidental Mutation 'R9131:Fig4'
ID 693652
Institutional Source Beutler Lab
Gene Symbol Fig4
Ensembl Gene ENSMUSG00000038417
Gene Name FIG4 phosphoinositide 5-phosphatase
Synonyms A530089I17Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_133999.1; MGI:2143585
Essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R9131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 41188172-41303260 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41265411 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 284 (F284Y)
Ref Sequence ENSEMBL: ENSMUSP00000039598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043814]
AlphaFold Q91WF7
Predicted Effect possibly damaging
Transcript: ENSMUST00000043814
AA Change: F284Y

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039598
Gene: ENSMUSG00000038417
AA Change: F284Y

DomainStartEndE-ValueType
Pfam:Syja_N 93 424 1.7e-79 PFAM
Blast:Lactamase_B 533 610 6e-21 BLAST
low complexity region 742 771 N/A INTRINSIC
low complexity region 805 813 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 3716838
Lethality: D30-D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, severe tremors, diluted coat color, neurodegeneration, impaired coordination, muscle weakness, small size and reduced spleen. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(3) Gene trapped(12) Spontaneous(1)
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,508 Y148F possibly damaging Het
Adamtsl3 A G 7: 82,595,514 T1393A probably benign Het
Adgrf4 G T 17: 42,667,367 Q362K probably benign Het
Akr1d1 A G 6: 37,554,516 K163R probably benign Het
Arhgap42 A G 9: 9,011,363 L474P probably damaging Het
Arhgef18 G A 8: 3,437,007 R242Q possibly damaging Het
Asah1 A G 8: 41,354,012 probably null Het
Atm A T 9: 53,533,744 I34N probably benign Het
Brms1l A G 12: 55,860,128 E160G possibly damaging Het
Camk2a C T 18: 60,943,255 H102Y unknown Het
Cd300lb A G 11: 114,928,308 V165A probably damaging Het
Cela1 G A 15: 100,681,157 R207C probably benign Het
Chd7 T C 4: 8,785,642 S649P Het
Clic3 A G 2: 25,458,313 Q130R probably benign Het
Clns1a G A 7: 97,713,918 G166R probably damaging Het
Cngb1 A T 8: 95,253,265 H1002Q probably benign Het
Cnnm1 C A 19: 43,441,400 A319E probably benign Het
Cntnap5b C T 1: 100,050,643 T128I probably benign Het
Csf3r G A 4: 126,030,020 D108N probably benign Het
Ctsc G A 7: 88,309,808 W432* probably null Het
Dapk1 G A 13: 60,761,394 G1274R probably damaging Het
Dennd2c C A 3: 103,157,715 P718Q probably damaging Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah7b C T 1: 46,227,020 R2250C probably damaging Het
Dnmt3a A T 12: 3,866,136 Q107L probably benign Het
Eml2 A G 7: 19,184,826 D67G Het
Eml5 A T 12: 98,858,840 V706E probably damaging Het
Eps8l1 A G 7: 4,477,574 D509G Het
Farsb T C 1: 78,483,314 K43E probably benign Het
Fbxw20 A G 9: 109,223,446 F273S probably damaging Het
Fsd1l C A 4: 53,694,756 N403K probably damaging Het
Fsip2 A T 2: 82,982,826 H3163L probably benign Het
Gm38119 C A 3: 92,738,096 G64* probably null Het
Gpr18 A G 14: 121,911,761 V284A probably benign Het
Hacd3 A G 9: 65,001,004 V170A probably damaging Het
Hps3 T C 3: 20,029,186 E281G probably damaging Het
Ick A T 9: 78,166,948 S551C possibly damaging Het
Ighv12-3 A C 12: 114,366,926 V10G probably benign Het
Lrp1b G A 2: 40,699,578 R3862* probably null Het
Ltbp4 A G 7: 27,337,551 L6P unknown Het
Ly6h T A 15: 75,565,673 T53S probably damaging Het
Ly6i A G 15: 74,983,157 probably benign Het
Mat2a G A 6: 72,436,244 R168C probably damaging Het
Mdn1 T A 4: 32,762,275 D5066E possibly damaging Het
Med23 T A 10: 24,904,381 F976I Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Mylk G T 16: 34,956,465 C1336F probably benign Het
Myo9a G C 9: 59,861,489 R918P probably damaging Het
Naglu T A 11: 101,076,905 D560E probably damaging Het
Nrg2 C T 18: 36,024,343 V430M probably damaging Het
Oit3 T C 10: 59,435,929 N202S probably benign Het
Olfr1453 T A 19: 13,027,996 Y111F probably benign Het
Olfr211 A G 6: 116,493,920 T104A probably benign Het
Olfr389 A T 11: 73,777,324 M1K probably null Het
Olfr569 T C 7: 102,887,979 H58R probably benign Het
Olfr766-ps1 C A 10: 129,063,228 V260F probably damaging Het
Otog T A 7: 46,303,173 C423* probably null Het
Pcolce T A 5: 137,605,508 T401S probably benign Het
Pcsk2 T C 2: 143,813,663 M589T possibly damaging Het
Pik3r5 T C 11: 68,492,273 L306P possibly damaging Het
Pikfyve T A 1: 65,246,080 M826K probably damaging Het
Ppp1r9a A G 6: 5,134,106 R898G possibly damaging Het
Prl7b1 A G 13: 27,606,985 V39A probably benign Het
Pros1 T A 16: 62,928,034 D623E probably damaging Het
Psg16 A G 7: 17,098,099 D320G probably benign Het
Ptpre T A 7: 135,679,146 H612Q probably damaging Het
Rbm34 A G 8: 126,953,178 S283P probably damaging Het
Rc3h2 A T 2: 37,414,690 N19K possibly damaging Het
Sacm1l T A 9: 123,552,762 L143* probably null Het
Sept9 T A 11: 117,290,634 S105T probably damaging Het
Shprh T C 10: 11,162,845 M448T possibly damaging Het
Slc6a20a A C 9: 123,636,998 *593E probably null Het
Smarcc1 A G 9: 110,135,642 D89G possibly damaging Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Tanc2 T C 11: 105,798,777 V255A probably benign Het
Tiam1 A G 16: 89,860,267 S694P probably damaging Het
Tmem130 T C 5: 144,743,719 T292A Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,214,377 probably benign Het
Tpcn2 A G 7: 145,260,925 Y480H probably damaging Het
Trf G T 9: 103,211,888 A600D probably damaging Het
Ttc16 A T 2: 32,769,220 L346Q probably damaging Het
Vars A C 17: 35,004,797 K229N possibly damaging Het
Vmn1r113 G T 7: 20,787,417 G45C probably damaging Het
Vmn1r32 A G 6: 66,553,036 V252A probably benign Het
Vmn2r93 A G 17: 18,325,881 T672A probably damaging Het
Wdfy4 T A 14: 33,097,850 T1466S Het
Zcwpw1 T C 5: 137,810,920 Y317H probably damaging Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp273 A T 13: 67,825,566 H271L probably damaging Het
Zfp764 C A 7: 127,406,547 E20* probably null Het
Znfx1 A T 2: 167,050,378 N639K probably benign Het
Other mutations in Fig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Fig4 APN 10 41251788 missense probably damaging 0.99
IGL01013:Fig4 APN 10 41267786 missense probably benign 0.00
IGL01066:Fig4 APN 10 41285417 splice site probably benign
IGL01501:Fig4 APN 10 41270374 missense probably benign
IGL01503:Fig4 APN 10 41256518 missense probably benign 0.00
IGL01535:Fig4 APN 10 41256494 missense probably benign 0.00
IGL01733:Fig4 APN 10 41277393 missense possibly damaging 0.49
IGL01782:Fig4 APN 10 41270400 missense probably benign 0.18
IGL01866:Fig4 APN 10 41232164 missense possibly damaging 0.77
IGL01934:Fig4 APN 10 41228112 missense probably benign 0.03
IGL01966:Fig4 APN 10 41232102 splice site probably null
IGL02032:Fig4 APN 10 41303006 missense probably benign 0.00
IGL02225:Fig4 APN 10 41256452 missense probably benign
IGL02345:Fig4 APN 10 41267774 missense probably null 1.00
IGL02532:Fig4 APN 10 41285281 splice site probably benign
IGL02686:Fig4 APN 10 41264004 missense probably damaging 0.99
IGL02965:Fig4 APN 10 41285665 missense probably damaging 0.98
P0021:Fig4 UTSW 10 41251825 missense probably damaging 1.00
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0117:Fig4 UTSW 10 41230041 nonsense probably null
R0144:Fig4 UTSW 10 41258049 missense probably damaging 0.99
R0655:Fig4 UTSW 10 41285677 missense probably damaging 1.00
R0701:Fig4 UTSW 10 41240512 nonsense probably null
R0751:Fig4 UTSW 10 41272982 missense probably damaging 1.00
R1540:Fig4 UTSW 10 41188586 missense possibly damaging 0.60
R1586:Fig4 UTSW 10 41265427 missense probably damaging 0.99
R2916:Fig4 UTSW 10 41258075 missense probably damaging 0.98
R3927:Fig4 UTSW 10 41263139 missense probably benign
R4304:Fig4 UTSW 10 41256427 missense probably benign 0.01
R4586:Fig4 UTSW 10 41188632 missense probably damaging 1.00
R4678:Fig4 UTSW 10 41272998 missense probably benign 0.27
R4858:Fig4 UTSW 10 41233590 missense probably benign 0.00
R5614:Fig4 UTSW 10 41272985 missense probably damaging 0.98
R5896:Fig4 UTSW 10 41254885 missense possibly damaging 0.67
R6126:Fig4 UTSW 10 41265447 missense probably damaging 0.99
R7056:Fig4 UTSW 10 41220932 missense probably benign 0.09
R7350:Fig4 UTSW 10 41251756 missense probably benign 0.03
R7452:Fig4 UTSW 10 41240637 missense possibly damaging 0.88
R7481:Fig4 UTSW 10 41230005 critical splice donor site probably null
R7610:Fig4 UTSW 10 41253713 missense probably damaging 1.00
R7818:Fig4 UTSW 10 41263166 missense probably damaging 0.98
R7830:Fig4 UTSW 10 41256466 missense probably benign 0.00
R8263:Fig4 UTSW 10 41267715 nonsense probably null
R8319:Fig4 UTSW 10 41263101 missense probably damaging 1.00
R8409:Fig4 UTSW 10 41265431 missense probably benign 0.01
R8435:Fig4 UTSW 10 41285674 missense probably benign
R8474:Fig4 UTSW 10 41232174 missense probably benign 0.30
R9086:Fig4 UTSW 10 41285403 missense possibly damaging 0.50
R9248:Fig4 UTSW 10 41277482 missense probably benign
R9401:Fig4 UTSW 10 41267737 missense probably benign
R9564:Fig4 UTSW 10 41285391 missense probably benign 0.20
R9627:Fig4 UTSW 10 41232182 missense probably benign 0.01
R9649:Fig4 UTSW 10 41267767 missense probably benign 0.00
Z1088:Fig4 UTSW 10 41253731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTTCAAAGCGCCATTGC -3'
(R):5'- TCCATGGAGCTTTTAGTGCC -3'

Sequencing Primer
(F):5'- GGCAATCTGATTCCATCCCTAGGAG -3'
(R):5'- CCATGGAGCTTTTAGTGCCTTAAG -3'
Posted On 2022-01-20