Incidental Mutation 'R9131:Pros1'
ID 693676
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Name protein S (alpha)
Synonyms protein S
Accession Numbers

Genbank: NM_011173; MGI: 1095733  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 62854307-62929346 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 62928034 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 623 (D623E)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
AlphaFold Q08761
Predicted Effect probably damaging
Transcript: ENSMUST00000023629
AA Change: D623E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: D623E

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,508 Y148F possibly damaging Het
Adamtsl3 A G 7: 82,595,514 T1393A probably benign Het
Adgrf4 G T 17: 42,667,367 Q362K probably benign Het
Akr1d1 A G 6: 37,554,516 K163R probably benign Het
Arhgap42 A G 9: 9,011,363 L474P probably damaging Het
Arhgef18 G A 8: 3,437,007 R242Q possibly damaging Het
Asah1 A G 8: 41,354,012 probably null Het
Atm A T 9: 53,533,744 I34N probably benign Het
Brms1l A G 12: 55,860,128 E160G possibly damaging Het
Camk2a C T 18: 60,943,255 H102Y unknown Het
Cd300lb A G 11: 114,928,308 V165A probably damaging Het
Cela1 G A 15: 100,681,157 R207C probably benign Het
Chd7 T C 4: 8,785,642 S649P Het
Clic3 A G 2: 25,458,313 Q130R probably benign Het
Clns1a G A 7: 97,713,918 G166R probably damaging Het
Cngb1 A T 8: 95,253,265 H1002Q probably benign Het
Cnnm1 C A 19: 43,441,400 A319E probably benign Het
Cntnap5b C T 1: 100,050,643 T128I probably benign Het
Csf3r G A 4: 126,030,020 D108N probably benign Het
Ctsc G A 7: 88,309,808 W432* probably null Het
Dapk1 G A 13: 60,761,394 G1274R probably damaging Het
Dennd2c C A 3: 103,157,715 P718Q probably damaging Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah7b C T 1: 46,227,020 R2250C probably damaging Het
Dnmt3a A T 12: 3,866,136 Q107L probably benign Het
Eml2 A G 7: 19,184,826 D67G Het
Eml5 A T 12: 98,858,840 V706E probably damaging Het
Eps8l1 A G 7: 4,477,574 D509G Het
Farsb T C 1: 78,483,314 K43E probably benign Het
Fbxw20 A G 9: 109,223,446 F273S probably damaging Het
Fig4 A T 10: 41,265,411 F284Y possibly damaging Het
Fsd1l C A 4: 53,694,756 N403K probably damaging Het
Fsip2 A T 2: 82,982,826 H3163L probably benign Het
Gm38119 C A 3: 92,738,096 G64* probably null Het
Gpr18 A G 14: 121,911,761 V284A probably benign Het
Hacd3 A G 9: 65,001,004 V170A probably damaging Het
Hps3 T C 3: 20,029,186 E281G probably damaging Het
Ick A T 9: 78,166,948 S551C possibly damaging Het
Ighv12-3 A C 12: 114,366,926 V10G probably benign Het
Lrp1b G A 2: 40,699,578 R3862* probably null Het
Ltbp4 A G 7: 27,337,551 L6P unknown Het
Ly6h T A 15: 75,565,673 T53S probably damaging Het
Ly6i A G 15: 74,983,157 probably benign Het
Mat2a G A 6: 72,436,244 R168C probably damaging Het
Mdn1 T A 4: 32,762,275 D5066E possibly damaging Het
Med23 T A 10: 24,904,381 F976I Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Mylk G T 16: 34,956,465 C1336F probably benign Het
Myo9a G C 9: 59,861,489 R918P probably damaging Het
Naglu T A 11: 101,076,905 D560E probably damaging Het
Nrg2 C T 18: 36,024,343 V430M probably damaging Het
Oit3 T C 10: 59,435,929 N202S probably benign Het
Olfr1453 T A 19: 13,027,996 Y111F probably benign Het
Olfr211 A G 6: 116,493,920 T104A probably benign Het
Olfr389 A T 11: 73,777,324 M1K probably null Het
Olfr569 T C 7: 102,887,979 H58R probably benign Het
Olfr766-ps1 C A 10: 129,063,228 V260F probably damaging Het
Otog T A 7: 46,303,173 C423* probably null Het
Pcolce T A 5: 137,605,508 T401S probably benign Het
Pcsk2 T C 2: 143,813,663 M589T possibly damaging Het
Pik3r5 T C 11: 68,492,273 L306P possibly damaging Het
Pikfyve T A 1: 65,246,080 M826K probably damaging Het
Ppp1r9a A G 6: 5,134,106 R898G possibly damaging Het
Prl7b1 A G 13: 27,606,985 V39A probably benign Het
Psg16 A G 7: 17,098,099 D320G probably benign Het
Ptpre T A 7: 135,679,146 H612Q probably damaging Het
Rbm34 A G 8: 126,953,178 S283P probably damaging Het
Rc3h2 A T 2: 37,414,690 N19K possibly damaging Het
Sacm1l T A 9: 123,552,762 L143* probably null Het
Sept9 T A 11: 117,290,634 S105T probably damaging Het
Shprh T C 10: 11,162,845 M448T possibly damaging Het
Slc6a20a A C 9: 123,636,998 *593E probably null Het
Smarcc1 A G 9: 110,135,642 D89G possibly damaging Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Tanc2 T C 11: 105,798,777 V255A probably benign Het
Tiam1 A G 16: 89,860,267 S694P probably damaging Het
Tmem130 T C 5: 144,743,719 T292A Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,214,377 probably benign Het
Tpcn2 A G 7: 145,260,925 Y480H probably damaging Het
Trf G T 9: 103,211,888 A600D probably damaging Het
Ttc16 A T 2: 32,769,220 L346Q probably damaging Het
Vars A C 17: 35,004,797 K229N possibly damaging Het
Vmn1r113 G T 7: 20,787,417 G45C probably damaging Het
Vmn1r32 A G 6: 66,553,036 V252A probably benign Het
Vmn2r93 A G 17: 18,325,881 T672A probably damaging Het
Wdfy4 T A 14: 33,097,850 T1466S Het
Zcwpw1 T C 5: 137,810,920 Y317H probably damaging Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp273 A T 13: 67,825,566 H271L probably damaging Het
Zfp764 C A 7: 127,406,547 E20* probably null Het
Znfx1 A T 2: 167,050,378 N639K probably benign Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62910045 missense probably damaging 0.99
IGL01300:Pros1 APN 16 62913811 missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62898945 missense probably damaging 0.99
IGL03080:Pros1 APN 16 62918143 missense probably damaging 0.98
IGL03095:Pros1 APN 16 62907769 nonsense probably null
F6893:Pros1 UTSW 16 62924639 missense probably damaging 0.98
R0124:Pros1 UTSW 16 62913946 missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62903518 missense probably benign 0.03
R1113:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1308:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1355:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1370:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1517:Pros1 UTSW 16 62885512 missense probably damaging 0.98
R1866:Pros1 UTSW 16 62928135 missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62903518 missense probably damaging 0.96
R2255:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62913848 missense probably damaging 0.99
R2369:Pros1 UTSW 16 62928069 missense probably damaging 1.00
R2979:Pros1 UTSW 16 62913866 missense probably damaging 0.99
R3724:Pros1 UTSW 16 62900329 missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62900645 nonsense probably null
R4556:Pros1 UTSW 16 62900673 missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62889007 critical splice donor site probably null
R4850:Pros1 UTSW 16 62885524 missense probably damaging 0.98
R4923:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62928185 missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62913976 missense probably benign 0.01
R5580:Pros1 UTSW 16 62926326 critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62928061 missense probably damaging 0.96
R5974:Pros1 UTSW 16 62900667 missense probably damaging 0.98
R6233:Pros1 UTSW 16 62898921 missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62924575 missense probably benign 0.01
R7055:Pros1 UTSW 16 62928102 missense possibly damaging 0.85
R7347:Pros1 UTSW 16 62919523 missense probably damaging 0.97
R7375:Pros1 UTSW 16 62924550 missense probably damaging 0.96
R7419:Pros1 UTSW 16 62928070 nonsense probably null
R7980:Pros1 UTSW 16 62928153 missense possibly damaging 0.86
R8234:Pros1 UTSW 16 62928177 missense possibly damaging 0.73
R8479:Pros1 UTSW 16 62907739 missense probably damaging 1.00
R8514:Pros1 UTSW 16 62910109 missense probably benign 0.03
R8827:Pros1 UTSW 16 62926464 missense probably benign 0.13
R9484:Pros1 UTSW 16 62924524 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCAATGAAGAACTCACGATGTGC -3'
(R):5'- GCCAGCTGGTGATAGGAATG -3'

Sequencing Primer
(F):5'- CGGAGCTCCATGCCCAG -3'
(R):5'- TAGGAATGTGAGCATAATTACAACG -3'
Posted On 2022-01-20