Incidental Mutation 'R9132:Dpyd'
ID 693693
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9132 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118917248 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 435 (I435N)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect probably damaging
Transcript: ENSMUST00000039177
AA Change: I435N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: I435N

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,292,062 T1705A possibly damaging Het
AC133488.1 A T 16: 18,621,325 V363E probably benign Het
Adamts16 A G 13: 70,753,289 S890P probably benign Het
Amd1 A G 10: 40,293,162 probably null Het
Apcs A G 1: 172,894,494 I95T probably damaging Het
Arhgap18 A G 10: 26,854,890 D188G probably benign Het
Arhgap42 C T 9: 9,011,418 V456M probably damaging Het
Atp2a2 T C 5: 122,461,570 Y586C probably damaging Het
BC055324 A G 1: 163,986,945 I143T probably damaging Het
Cbr1 G C 16: 93,609,906 G170A probably benign Het
Cfap53 T A 18: 74,283,201 Y2N probably damaging Het
Clcn3 A G 8: 60,929,102 I511T probably damaging Het
Col28a1 T A 6: 8,014,993 D804V probably damaging Het
Csmd2 A G 4: 128,549,214 T3253A Het
Cyp2c40 A T 19: 39,773,873 D443E probably damaging Het
Cyp7b1 A G 3: 18,097,312 C246R probably benign Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Fat2 A T 11: 55,298,610 L1194Q possibly damaging Het
Gabrg1 A T 5: 70,782,279 I170N possibly damaging Het
Gm5416 G A 16: 36,217,699 V69I probably benign Het
Gon4l C T 3: 88,908,177 P2016S probably benign Het
Hax1 T C 3: 89,995,820 R251G probably damaging Het
Hbq1b A T 11: 32,287,228 K41* probably null Het
Ido2 G A 8: 24,533,917 P302S probably damaging Het
Igf2bp2 G A 16: 22,081,752 T213I probably damaging Het
Itga2 A T 13: 114,877,762 L210* probably null Het
Kdm1b G A 13: 47,071,982 S547N probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Lyz2 A T 10: 117,280,657 C95* probably null Het
Mafa A T 15: 75,747,199 S242T possibly damaging Het
Mapk1 T C 16: 17,038,436 probably null Het
Mta1 T A 12: 113,136,405 V645E probably damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Naa35 T C 13: 59,624,527 I438T possibly damaging Het
Necab2 T C 8: 119,462,564 Y158H probably damaging Het
Nphp3 T A 9: 104,020,781 L523Q probably damaging Het
Ogdh A T 11: 6,340,488 I369F probably benign Het
Pglyrp4 C T 3: 90,727,931 Q28* probably null Het
Pla2g4a C T 1: 149,871,479 V319I probably benign Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Prdm6 C A 18: 53,464,947 A127D unknown Het
Prop1 T G 11: 50,952,210 E50A Het
Ripk1 A G 13: 34,028,201 N498S probably benign Het
Rnf213 A G 11: 119,483,916 N5069S Het
Saa3 T C 7: 46,712,697 D41G probably damaging Het
Setd2 T C 9: 110,545,317 probably null Het
Shbg G A 11: 69,615,604 L327F probably benign Het
Slc1a4 C T 11: 20,308,527 G304D probably damaging Het
Slf1 T C 13: 77,100,954 K372E probably benign Het
Smad2 T A 18: 76,262,502 I4N possibly damaging Het
Smad6 A C 9: 64,007,588 S300A probably benign Het
Syde1 T C 10: 78,589,506 S224G probably benign Het
Tacc1 A T 8: 25,182,135 V359E possibly damaging Het
Tex15 T G 8: 33,577,526 V2328G possibly damaging Het
Tmem43 A C 6: 91,482,309 D254A probably benign Het
Trav6d-3 T A 14: 52,726,753 Y58N possibly damaging Het
Trrap A G 5: 144,789,552 E437G probably benign Het
Wars A G 12: 108,861,273 F474L probably benign Het
Wdr78 A G 4: 103,059,733 M592T probably damaging Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp541 T A 7: 16,083,041 V918D probably benign Het
Zfp747 T C 7: 127,375,750 D26G probably damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGGATAGTCAACGTTTCTCAAG -3'
(R):5'- TTGAATCAAAATCGCTCGCAG -3'

Sequencing Primer
(F):5'- CATTTTAGATGGAGCTCGCTAAG -3'
(R):5'- TCGCTCGCAGTACATACAAG -3'
Posted On 2022-01-20