Incidental Mutation 'R9132:Mta1'
ID 693729
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Name metastasis associated 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9132 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 113098278-113137206 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113136405 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 645 (V645E)
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000084882] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727] [ENSMUST00000200380]
AlphaFold Q8K4B0
Predicted Effect probably damaging
Transcript: ENSMUST00000009099
AA Change: V657E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: V657E

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069690
AA Change: V640E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: V640E

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084882
SMART Domains Protein: ENSMUSP00000081943
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 4 56 2.08e-12 SMART
low complexity region 104 115 N/A INTRINSIC
LIM 125 177 6.05e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109723
AA Change: V645E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: V645E

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109726
AA Change: V640E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: V640E

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109727
AA Change: V645E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: V645E

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200380
SMART Domains Protein: ENSMUSP00000143334
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 1 53 3e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,292,062 T1705A possibly damaging Het
AC133488.1 A T 16: 18,621,325 V363E probably benign Het
Adamts16 A G 13: 70,753,289 S890P probably benign Het
Amd1 A G 10: 40,293,162 probably null Het
Apcs A G 1: 172,894,494 I95T probably damaging Het
Arhgap18 A G 10: 26,854,890 D188G probably benign Het
Arhgap42 C T 9: 9,011,418 V456M probably damaging Het
Atp2a2 T C 5: 122,461,570 Y586C probably damaging Het
BC055324 A G 1: 163,986,945 I143T probably damaging Het
Cbr1 G C 16: 93,609,906 G170A probably benign Het
Cfap53 T A 18: 74,283,201 Y2N probably damaging Het
Clcn3 A G 8: 60,929,102 I511T probably damaging Het
Col28a1 T A 6: 8,014,993 D804V probably damaging Het
Csmd2 A G 4: 128,549,214 T3253A Het
Cyp2c40 A T 19: 39,773,873 D443E probably damaging Het
Cyp7b1 A G 3: 18,097,312 C246R probably benign Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dpyd T A 3: 118,917,248 I435N probably damaging Het
Fat2 A T 11: 55,298,610 L1194Q possibly damaging Het
Gabrg1 A T 5: 70,782,279 I170N possibly damaging Het
Gm5416 G A 16: 36,217,699 V69I probably benign Het
Gon4l C T 3: 88,908,177 P2016S probably benign Het
Hax1 T C 3: 89,995,820 R251G probably damaging Het
Hbq1b A T 11: 32,287,228 K41* probably null Het
Ido2 G A 8: 24,533,917 P302S probably damaging Het
Igf2bp2 G A 16: 22,081,752 T213I probably damaging Het
Itga2 A T 13: 114,877,762 L210* probably null Het
Kdm1b G A 13: 47,071,982 S547N probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Lyz2 A T 10: 117,280,657 C95* probably null Het
Mafa A T 15: 75,747,199 S242T possibly damaging Het
Mapk1 T C 16: 17,038,436 probably null Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Naa35 T C 13: 59,624,527 I438T possibly damaging Het
Necab2 T C 8: 119,462,564 Y158H probably damaging Het
Nphp3 T A 9: 104,020,781 L523Q probably damaging Het
Ogdh A T 11: 6,340,488 I369F probably benign Het
Pglyrp4 C T 3: 90,727,931 Q28* probably null Het
Pla2g4a C T 1: 149,871,479 V319I probably benign Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Prdm6 C A 18: 53,464,947 A127D unknown Het
Prop1 T G 11: 50,952,210 E50A Het
Ripk1 A G 13: 34,028,201 N498S probably benign Het
Rnf213 A G 11: 119,483,916 N5069S Het
Saa3 T C 7: 46,712,697 D41G probably damaging Het
Setd2 T C 9: 110,545,317 probably null Het
Shbg G A 11: 69,615,604 L327F probably benign Het
Slc1a4 C T 11: 20,308,527 G304D probably damaging Het
Slf1 T C 13: 77,100,954 K372E probably benign Het
Smad2 T A 18: 76,262,502 I4N possibly damaging Het
Smad6 A C 9: 64,007,588 S300A probably benign Het
Syde1 T C 10: 78,589,506 S224G probably benign Het
Tacc1 A T 8: 25,182,135 V359E possibly damaging Het
Tex15 T G 8: 33,577,526 V2328G possibly damaging Het
Tmem43 A C 6: 91,482,309 D254A probably benign Het
Trav6d-3 T A 14: 52,726,753 Y58N possibly damaging Het
Trrap A G 5: 144,789,552 E437G probably benign Het
Wars A G 12: 108,861,273 F474L probably benign Het
Wdr78 A G 4: 103,059,733 M592T probably damaging Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp541 T A 7: 16,083,041 V918D probably benign Het
Zfp747 T C 7: 127,375,750 D26G probably damaging Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0361:Mta1 UTSW 12 113133341 splice site probably null
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2110:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4231:Mta1 UTSW 12 113135827 missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5032:Mta1 UTSW 12 113133525 splice site probably null
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5392:Mta1 UTSW 12 113133236 missense probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R5903:Mta1 UTSW 12 113136619 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
R7334:Mta1 UTSW 12 113126798 missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113131468 critical splice donor site probably null
R7889:Mta1 UTSW 12 113131688 missense probably benign 0.02
R8136:Mta1 UTSW 12 113131678 missense probably damaging 1.00
R8176:Mta1 UTSW 12 113120836 missense probably benign 0.00
R8385:Mta1 UTSW 12 113131465 missense probably benign
R8398:Mta1 UTSW 12 113131622 missense possibly damaging 0.83
R9159:Mta1 UTSW 12 113136405 missense probably damaging 1.00
R9418:Mta1 UTSW 12 113131367 missense probably damaging 1.00
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AAGGTCAGGGTACTGTCTTCCTG -3'
(R):5'- ATCATTGACTGGTGCAGGTG -3'

Sequencing Primer
(F):5'- AGGGTACTGTCTTCCTGTGTCC -3'
(R):5'- CGCAGGGCAATGGGTTTG -3'
Posted On 2022-01-20