Incidental Mutation 'R9132:Trav6d-3'
ID 693737
Institutional Source Beutler Lab
Gene Symbol Trav6d-3
Ensembl Gene ENSMUSG00000096600
Gene Name T cell receptor alpha variable 6D-3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R9132 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52725299-52726917 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52726753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 58 (Y58N)
Ref Sequence ENSEMBL: ENSMUSP00000137760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181483] [ENSMUST00000184883]
AlphaFold A0A075B6D3
Predicted Effect possibly damaging
Transcript: ENSMUST00000181483
AA Change: Y58N

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137760
Gene: ENSMUSG00000096600
AA Change: Y58N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:V-set 21 112 2.9e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184883
AA Change: Y48N

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139137
Gene: ENSMUSG00000096600
AA Change: Y48N

DomainStartEndE-ValueType
Pfam:V-set 11 102 3.8e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,292,062 T1705A possibly damaging Het
AC133488.1 A T 16: 18,621,325 V363E probably benign Het
Adamts16 A G 13: 70,753,289 S890P probably benign Het
Amd1 A G 10: 40,293,162 probably null Het
Apcs A G 1: 172,894,494 I95T probably damaging Het
Arhgap18 A G 10: 26,854,890 D188G probably benign Het
Arhgap42 C T 9: 9,011,418 V456M probably damaging Het
Atp2a2 T C 5: 122,461,570 Y586C probably damaging Het
BC055324 A G 1: 163,986,945 I143T probably damaging Het
Cbr1 G C 16: 93,609,906 G170A probably benign Het
Cdh23 T A 10: 60,434,504 probably benign Het
Cfap53 T A 18: 74,283,201 Y2N probably damaging Het
Clcn3 A G 8: 60,929,102 I511T probably damaging Het
Col28a1 T A 6: 8,014,993 D804V probably damaging Het
Csmd2 A G 4: 128,549,214 T3253A Het
Cyp2c40 A T 19: 39,773,873 D443E probably damaging Het
Cyp7b1 A G 3: 18,097,312 C246R probably benign Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dpyd T A 3: 118,917,248 I435N probably damaging Het
Fat2 A T 11: 55,298,610 L1194Q possibly damaging Het
Gabrg1 A T 5: 70,782,279 I170N possibly damaging Het
Gm5416 G A 16: 36,217,699 V69I probably benign Het
Gon4l C T 3: 88,908,177 P2016S probably benign Het
Hax1 T C 3: 89,995,820 R251G probably damaging Het
Hbq1b A T 11: 32,287,228 K41* probably null Het
Ido2 G A 8: 24,533,917 P302S probably damaging Het
Igf2bp2 G A 16: 22,081,752 T213I probably damaging Het
Itga2 A T 13: 114,877,762 L210* probably null Het
Kdm1b G A 13: 47,071,982 S547N probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Lyz2 A T 10: 117,280,657 C95* probably null Het
Mafa A T 15: 75,747,199 S242T possibly damaging Het
Mapk1 T C 16: 17,038,436 probably null Het
Mta1 T A 12: 113,136,405 V645E probably damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Naa35 T C 13: 59,624,527 I438T possibly damaging Het
Necab2 T C 8: 119,462,564 Y158H probably damaging Het
Nphp3 T A 9: 104,020,781 L523Q probably damaging Het
Ogdh A T 11: 6,340,488 I369F probably benign Het
Pglyrp4 C T 3: 90,727,931 Q28* probably null Het
Pla2g4a C T 1: 149,871,479 V319I probably benign Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Prdm6 C A 18: 53,464,947 A127D unknown Het
Prop1 T G 11: 50,952,210 E50A Het
Ripk1 A G 13: 34,028,201 N498S probably benign Het
Rnf213 A G 11: 119,483,916 N5069S Het
Saa3 T C 7: 46,712,697 D41G probably damaging Het
Setd2 T C 9: 110,545,317 probably null Het
Shbg G A 11: 69,615,604 L327F probably benign Het
Slc12a5 G A 2: 164,993,956 probably benign Het
Slc1a4 C T 11: 20,308,527 G304D probably damaging Het
Slf1 T C 13: 77,100,954 K372E probably benign Het
Smad2 T A 18: 76,262,502 I4N possibly damaging Het
Smad6 A C 9: 64,007,588 S300A probably benign Het
Spem2 T A 11: 69,816,588 probably benign Het
Syde1 T C 10: 78,589,506 S224G probably benign Het
Tacc1 A T 8: 25,182,135 V359E possibly damaging Het
Tex15 T G 8: 33,577,526 V2328G possibly damaging Het
Tmem43 A C 6: 91,482,309 D254A probably benign Het
Trrap A G 5: 144,789,552 E437G probably benign Het
Wars A G 12: 108,861,273 F474L probably benign Het
Wdr78 A G 4: 103,059,733 M592T probably damaging Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp541 T A 7: 16,083,041 V918D probably benign Het
Zfp747 T C 7: 127,375,750 D26G probably damaging Het
Other mutations in Trav6d-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
teed_off UTSW 14 52725342 missense probably damaging 1.00
R2445:Trav6d-3 UTSW 14 52726828 missense probably damaging 1.00
R4173:Trav6d-3 UTSW 14 52725349 missense probably benign 0.00
R7215:Trav6d-3 UTSW 14 52725342 missense probably damaging 1.00
R9599:Trav6d-3 UTSW 14 52726687 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GTGCACTCTTCTATGATGTCAGA -3'
(R):5'- AGACTTTATGCTCAGCTGCCC -3'

Sequencing Primer
(F):5'- CAAGGTCAAGTGACCCTT -3'
(R):5'- AGTTTCTGCCACTGTGTCACTCATAG -3'
Posted On 2022-01-20