Incidental Mutation 'R9133:Ighv9-4'
ID 693797
Institutional Source Beutler Lab
Gene Symbol Ighv9-4
Ensembl Gene ENSMUSG00000094322
Gene Name immunoglobulin heavy variable 9-4
Synonyms Gm7175
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock # R9133 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 114299961-114300389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114300263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 17 (I17F)
Ref Sequence ENSEMBL: ENSMUSP00000141555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103482] [ENSMUST00000194159]
AlphaFold A0A075B5S9
Predicted Effect probably benign
Transcript: ENSMUST00000103482
SMART Domains Protein: ENSMUSP00000100263
Gene: ENSMUSG00000094322

DomainStartEndE-ValueType
IGv 17 98 1.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194159
AA Change: I17F

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141555
Gene: ENSMUSG00000094322
AA Change: I17F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 5.2e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 T A 17: 12,940,289 R4S probably benign Het
Adamdec1 A T 14: 68,577,098 C143* probably null Het
Adck5 A G 15: 76,576,412 probably benign Het
Aebp2 A G 6: 140,633,715 D226G probably damaging Het
Ascc3 A G 10: 50,754,079 I1755V possibly damaging Het
Aspm C T 1: 139,491,528 T2977M probably damaging Het
Cacna1a A G 8: 84,549,523 S582G probably damaging Het
Card14 T C 11: 119,341,009 F801S probably damaging Het
Casp16-ps T A 17: 23,552,029 D134V probably damaging Het
Cmya5 A G 13: 93,097,600 S327P possibly damaging Het
Cutc A T 19: 43,767,288 D229V possibly damaging Het
Cyp21a1 C A 17: 34,804,445 probably benign Het
Dnah10 A G 5: 124,782,359 K2130R probably damaging Het
Dsc1 C T 18: 20,101,847 S250N probably benign Het
Edc4 T C 8: 105,885,146 probably null Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Ehmt1 A T 2: 24,839,623 I642K possibly damaging Het
Gjd2 T C 2: 114,011,558 Q146R probably benign Het
Gm26661 A G 14: 7,791,936 H117R unknown Het
H2-Oa T A 17: 34,094,531 D185E probably damaging Het
Hyal6 A G 6: 24,734,586 R173G possibly damaging Het
Ica1 A T 6: 8,659,921 V125D probably benign Het
Ift172 T C 5: 31,285,523 T140A probably benign Het
Igkv4-92 G T 6: 68,755,264 T42N probably damaging Het
Kctd16 C A 18: 40,259,016 P219Q probably damaging Het
Kdm5b A T 1: 134,602,585 I445F probably benign Het
Ksr2 A G 5: 117,703,254 T598A probably benign Het
Lrrn1 C T 6: 107,567,607 T122I probably damaging Het
Mars2 A G 1: 55,237,562 D108G possibly damaging Het
Ms4a14 A G 19: 11,303,674 W507R Het
Ncoa3 A G 2: 166,068,461 T1266A possibly damaging Het
Neb T C 2: 52,193,244 K5650E possibly damaging Het
Nlrp4f T A 13: 65,185,069 K92* probably null Het
Nme4 G T 17: 26,095,415 A13E probably benign Het
Nova1 G T 12: 46,818,741 A4E unknown Het
Nphs1 G T 7: 30,460,667 E124* probably null Het
Olfr1162 T C 2: 88,050,438 Y62C probably damaging Het
Olfr960 T A 9: 39,623,513 L128* probably null Het
Olfr963 T A 9: 39,669,678 I207N possibly damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Ranbp2 T C 10: 58,477,228 S1257P probably damaging Het
Ranbp3 T C 17: 56,696,791 probably null Het
Rasgrf1 A G 9: 89,911,547 T126A probably benign Het
Rexo5 T G 7: 119,845,444 L714R probably damaging Het
Rhobtb3 A G 13: 75,872,393 Y597H probably damaging Het
Riox1 C G 12: 83,951,447 Y252* probably null Het
Sh2d3c T C 2: 32,744,766 Y186H possibly damaging Het
Slc16a7 T A 10: 125,230,667 T368S probably benign Het
Slc25a26 G A 6: 94,534,162 V107I Het
Slc4a5 A T 6: 83,226,235 Y39F possibly damaging Het
Smarcad1 A G 6: 65,072,051 K254E probably damaging Het
Sspo G T 6: 48,457,813 V1080L possibly damaging Het
Thsd7b A T 1: 129,915,645 T865S probably benign Het
Top1 C T 2: 160,703,671 Q320* probably null Het
Trank1 T A 9: 111,391,702 N2502K possibly damaging Het
Urad T C 5: 147,315,441 H67R probably damaging Het
Vamp5 A C 6: 72,380,379 probably null Het
Vmn1r62 A G 7: 5,676,063 I248V probably benign Het
Wwc2 G T 8: 47,851,972 Q873K unknown Het
Zcchc2 C A 1: 106,030,805 S1002Y probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Zfp788 A G 7: 41,650,060 N707D Het
Zfp964 A G 8: 69,663,133 T128A probably benign Het
Zkscan16 T C 4: 58,957,722 L668S possibly damaging Het
Other mutations in Ighv9-4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Ighv9-4 APN 12 114299992 missense probably damaging 0.98
R4258:Ighv9-4 UTSW 12 114300145 missense probably damaging 0.99
R5244:Ighv9-4 UTSW 12 114300251 missense probably benign 0.00
R7133:Ighv9-4 UTSW 12 114300137 missense probably benign 0.00
R7687:Ighv9-4 UTSW 12 114300263 missense not run
Predicted Primers PCR Primer
(F):5'- AGAAGGCAAACCGTCCCTTG -3'
(R):5'- GCAAGAGAGTGTCCGGTTAGTC -3'

Sequencing Primer
(F):5'- GGCAAACCGTCCCTTGAAGTC -3'
(R):5'- TCCGGTTAGTCTCAAGGAAGACTG -3'
Posted On 2022-01-20