Incidental Mutation 'R9134:Bpifb9b'
ID 693821
Institutional Source Beutler Lab
Gene Symbol Bpifb9b
Ensembl Gene ENSMUSG00000067996
Gene Name BPI fold containing family B, member 9B
Synonyms 5430413K10Rik, OTTMUSG00000015915
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R9134 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 154149164-154162564 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 154151441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 54 (V54A)
Ref Sequence ENSEMBL: ENSMUSP00000086311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088921]
AlphaFold A2AJD1
Predicted Effect probably benign
Transcript: ENSMUST00000088921
AA Change: V54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086311
Gene: ENSMUSG00000067996
AA Change: V54A

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.7e-11 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap1m1 A G 8: 72,993,913 (GRCm39) probably benign Het
Arhgdia A T 11: 120,470,392 (GRCm39) I122N probably damaging Het
Atad2b T A 12: 5,060,351 (GRCm39) H915Q probably benign Het
Atad5 G A 11: 80,023,931 (GRCm39) R1681K probably benign Het
Cby3 A C 11: 50,250,153 (GRCm39) T25P probably damaging Het
Ccdc138 T G 10: 58,374,102 (GRCm39) L374R probably damaging Het
Cd84 T A 1: 171,679,413 (GRCm39) N30K probably damaging Het
Cdk20 T A 13: 64,580,906 (GRCm39) probably null Het
Chd9 A G 8: 91,659,754 (GRCm39) H238R unknown Het
Cplane1 T C 15: 8,228,716 (GRCm39) V929A probably damaging Het
Csl T A 10: 99,594,237 (GRCm39) H276L probably damaging Het
Dchs1 A G 7: 105,404,910 (GRCm39) L2544P probably damaging Het
Dnah17 T C 11: 117,978,972 (GRCm39) T1807A probably damaging Het
Dph7 C T 2: 24,861,720 (GRCm39) H378Y probably benign Het
Enkur T C 2: 21,185,779 (GRCm39) I249V probably benign Het
Fam117a C A 11: 95,271,745 (GRCm39) S439* probably null Het
Fam184a T G 10: 53,573,344 (GRCm39) K345N probably damaging Het
Fam228a T C 12: 4,765,686 (GRCm39) R255G probably benign Het
Fpr-rs7 A T 17: 20,334,325 (GRCm39) M55K probably damaging Het
Frem2 A G 3: 53,562,321 (GRCm39) Y729H probably damaging Het
Herc2 A G 7: 55,832,177 (GRCm39) T2989A probably damaging Het
Hspb8 A G 5: 116,547,547 (GRCm39) L145P probably damaging Het
Iars1 T A 13: 49,855,323 (GRCm39) V250E probably benign Het
Ide G T 19: 37,273,561 (GRCm39) probably benign Het
Ino80c T C 18: 24,254,765 (GRCm39) S32G probably benign Het
Insr G A 8: 3,308,413 (GRCm39) R208W probably damaging Het
Ints1 G A 5: 139,743,351 (GRCm39) R1674W probably benign Het
Itsn1 G A 16: 91,666,514 (GRCm39) V1153M unknown Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lrrc41 C A 4: 115,945,782 (GRCm39) Q166K possibly damaging Het
Lrriq3 T C 3: 154,820,183 (GRCm39) probably null Het
Mndal T C 1: 173,699,096 (GRCm39) I190V unknown Het
Nisch TCTGCTGC TCTGCTGCTGC 14: 30,896,637 (GRCm39) probably benign Het
Nme4 G T 17: 26,314,389 (GRCm39) A13E probably benign Het
Or14c39 C A 7: 86,344,588 (GRCm39) S308* probably null Het
Or3a1 A G 11: 74,225,670 (GRCm39) I129T probably damaging Het
Or5b114-ps1 G T 19: 13,352,613 (GRCm39) A96S probably damaging Het
Pcmt1 A T 10: 7,520,207 (GRCm39) probably benign Het
Pde4c G T 8: 71,201,160 (GRCm39) V493F probably damaging Het
Pde8a C T 7: 80,982,619 (GRCm39) T746I probably damaging Het
Pira13 T C 7: 3,825,182 (GRCm39) S487G Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Prr23a1 T C 9: 98,724,935 (GRCm39) L99P Het
Rex2 C G 4: 147,142,643 (GRCm39) T377S probably benign Het
Robo2 A G 16: 73,703,738 (GRCm39) F50L Het
Srgap1 A G 10: 121,883,127 (GRCm39) probably benign Het
Syt3 A G 7: 44,042,791 (GRCm39) N358D possibly damaging Het
Tfec T A 6: 16,835,326 (GRCm39) T151S probably damaging Het
Tll1 A T 8: 64,469,201 (GRCm39) I974N possibly damaging Het
Tmc2 T C 2: 130,074,321 (GRCm39) V338A probably benign Het
Trappc6b T A 12: 59,097,160 (GRCm39) D54V probably damaging Het
Trav6-2 T A 14: 52,905,109 (GRCm39) C43* probably null Het
Ubr4 T A 4: 139,127,755 (GRCm39) probably null Het
Vmn1r2 T A 4: 3,172,884 (GRCm39) W268R probably damaging Het
Vmn2r120 A G 17: 57,832,093 (GRCm39) L232S probably damaging Het
Vps26b T C 9: 26,921,225 (GRCm39) T325A probably benign Het
Vwa3a T C 7: 120,377,659 (GRCm39) V438A probably damaging Het
Wdcp C A 12: 4,901,533 (GRCm39) S463* probably null Het
Xkr4 C T 1: 3,740,860 (GRCm39) G238S probably benign Het
Zranb1 A G 7: 132,551,886 (GRCm39) N179S probably benign Het
Other mutations in Bpifb9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Bpifb9b APN 2 154,158,871 (GRCm39) splice site probably null
IGL02119:Bpifb9b APN 2 154,155,544 (GRCm39) missense possibly damaging 0.84
IGL02658:Bpifb9b APN 2 154,153,201 (GRCm39) missense probably benign 0.00
R0230:Bpifb9b UTSW 2 154,158,995 (GRCm39) missense probably damaging 1.00
R0269:Bpifb9b UTSW 2 154,161,545 (GRCm39) missense probably benign 0.00
R0617:Bpifb9b UTSW 2 154,161,545 (GRCm39) missense probably benign 0.00
R1953:Bpifb9b UTSW 2 154,153,234 (GRCm39) missense probably damaging 0.99
R2050:Bpifb9b UTSW 2 154,151,524 (GRCm39) missense possibly damaging 0.93
R2160:Bpifb9b UTSW 2 154,161,595 (GRCm39) missense possibly damaging 0.53
R2200:Bpifb9b UTSW 2 154,155,574 (GRCm39) missense probably benign 0.00
R2354:Bpifb9b UTSW 2 154,153,662 (GRCm39) missense probably benign
R4755:Bpifb9b UTSW 2 154,161,614 (GRCm39) missense probably benign 0.01
R4872:Bpifb9b UTSW 2 154,155,551 (GRCm39) missense probably damaging 0.99
R4914:Bpifb9b UTSW 2 154,156,026 (GRCm39) splice site probably null
R4915:Bpifb9b UTSW 2 154,156,026 (GRCm39) splice site probably null
R4917:Bpifb9b UTSW 2 154,156,026 (GRCm39) splice site probably null
R4918:Bpifb9b UTSW 2 154,156,026 (GRCm39) splice site probably null
R4950:Bpifb9b UTSW 2 154,153,579 (GRCm39) missense probably damaging 1.00
R5438:Bpifb9b UTSW 2 154,151,288 (GRCm39) missense possibly damaging 0.65
R5507:Bpifb9b UTSW 2 154,158,947 (GRCm39) missense possibly damaging 0.91
R6255:Bpifb9b UTSW 2 154,151,284 (GRCm39) missense probably damaging 0.98
R7130:Bpifb9b UTSW 2 154,153,592 (GRCm39) missense probably damaging 0.98
R7161:Bpifb9b UTSW 2 154,155,535 (GRCm39) missense possibly damaging 0.95
R7736:Bpifb9b UTSW 2 154,154,025 (GRCm39) missense probably benign 0.00
R8536:Bpifb9b UTSW 2 154,158,197 (GRCm39) missense probably benign 0.00
R9348:Bpifb9b UTSW 2 154,160,766 (GRCm39) missense probably benign 0.28
R9528:Bpifb9b UTSW 2 154,153,297 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAATTTGATGTGCTACCCAC -3'
(R):5'- TGATTGAACTCCTCCTAAGCTCAG -3'

Sequencing Primer
(F):5'- CTCTTCAGGTTTCAGCCACAAAGATG -3'
(R):5'- TCAGAATTGAGCAGCCCCTG -3'
Posted On 2022-01-20