Incidental Mutation 'R9134:Bpifb9b'
ID 693821
Institutional Source Beutler Lab
Gene Symbol Bpifb9b
Ensembl Gene ENSMUSG00000067996
Gene Name BPI fold containing family B, member 9B
Synonyms OTTMUSG00000015915, 5430413K10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock # R9134 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 154307227-154320646 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 154309521 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 54 (V54A)
Ref Sequence ENSEMBL: ENSMUSP00000086311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088921]
AlphaFold A2AJD1
Predicted Effect probably benign
Transcript: ENSMUST00000088921
AA Change: V54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086311
Gene: ENSMUSG00000067996
AA Change: V54A

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.7e-11 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,199,232 V929A probably damaging Het
Ap1m1 A G 8: 72,240,069 probably benign Het
Arhgdia A T 11: 120,579,566 I122N probably damaging Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Atad5 G A 11: 80,133,105 R1681K probably benign Het
Cby3 A C 11: 50,359,326 T25P probably damaging Het
Ccdc138 T G 10: 58,538,280 L374R probably damaging Het
Cd84 T A 1: 171,851,846 N30K probably damaging Het
Cdk20 T A 13: 64,433,092 probably null Het
Chd9 A G 8: 90,933,126 H238R unknown Het
Csl T A 10: 99,758,375 H276L probably damaging Het
Dchs1 A G 7: 105,755,703 L2544P probably damaging Het
Dnah17 T C 11: 118,088,146 T1807A probably damaging Het
Dph7 C T 2: 24,971,708 H378Y probably benign Het
Enkur T C 2: 21,180,968 I249V probably benign Het
Fam117a C A 11: 95,380,919 S439* probably null Het
Fam184a T G 10: 53,697,248 K345N probably damaging Het
Fam228a T C 12: 4,715,686 R255G probably benign Het
Fpr-rs7 A T 17: 20,114,063 M55K probably damaging Het
Frem2 A G 3: 53,654,900 Y729H probably damaging Het
Gm15448 T C 7: 3,822,183 S487G Het
Herc2 A G 7: 56,182,429 T2989A probably damaging Het
Hspb8 A G 5: 116,409,488 L145P probably damaging Het
Iars T A 13: 49,701,847 V250E probably benign Het
Ide G T 19: 37,296,162 probably benign Het
Ino80c T C 18: 24,121,708 S32G probably benign Het
Insr G A 8: 3,258,413 R208W probably damaging Het
Ints1 G A 5: 139,757,596 R1674W probably benign Het
Itsn1 G A 16: 91,869,626 V1153M unknown Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrrc41 C A 4: 116,088,585 Q166K possibly damaging Het
Lrriq3 T C 3: 155,114,546 probably null Het
Mndal T C 1: 173,871,530 I190V unknown Het
Nisch TCTGCTGC TCTGCTGCTGC 14: 31,174,680 probably benign Het
Nme4 G T 17: 26,095,415 A13E probably benign Het
Olfr1468-ps1 G T 19: 13,375,249 A96S probably damaging Het
Olfr292 C A 7: 86,695,380 S308* probably null Het
Olfr410 A G 11: 74,334,844 I129T probably damaging Het
Pcmt1 A T 10: 7,644,443 probably benign Het
Pde4c G T 8: 70,748,511 V493F probably damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prr23a1 T C 9: 98,842,882 L99P Het
Rex2 C G 4: 147,058,186 T377S probably benign Het
Robo2 A G 16: 73,906,850 F50L Het
Srgap1 A G 10: 122,047,222 probably benign Het
Syt3 A G 7: 44,393,367 N358D possibly damaging Het
Tfec T A 6: 16,835,327 T151S probably damaging Het
Tll1 A T 8: 64,016,167 I974N possibly damaging Het
Tmc2 T C 2: 130,232,401 V338A probably benign Het
Trappc6b T A 12: 59,050,374 D54V probably damaging Het
Trav6-2 T A 14: 52,667,652 C43* probably null Het
Ubr4 T A 4: 139,400,444 probably null Het
Vmn1r2 T A 4: 3,172,884 W268R probably damaging Het
Vmn2r120 A G 17: 57,525,093 L232S probably damaging Het
Vps26b T C 9: 27,009,929 T325A probably benign Het
Vwa3a T C 7: 120,778,436 V438A probably damaging Het
Wdcp C A 12: 4,851,533 S463* probably null Het
Xkr4 C T 1: 3,670,637 G238S probably benign Het
Zranb1 A G 7: 132,950,157 N179S probably benign Het
Other mutations in Bpifb9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Bpifb9b APN 2 154316951 splice site probably null
IGL02119:Bpifb9b APN 2 154313624 missense possibly damaging 0.84
IGL02658:Bpifb9b APN 2 154311281 missense probably benign 0.00
R0230:Bpifb9b UTSW 2 154317075 missense probably damaging 1.00
R0269:Bpifb9b UTSW 2 154319625 missense probably benign 0.00
R0617:Bpifb9b UTSW 2 154319625 missense probably benign 0.00
R1953:Bpifb9b UTSW 2 154311314 missense probably damaging 0.99
R2050:Bpifb9b UTSW 2 154309604 missense possibly damaging 0.93
R2160:Bpifb9b UTSW 2 154319675 missense possibly damaging 0.53
R2200:Bpifb9b UTSW 2 154313654 missense probably benign 0.00
R2354:Bpifb9b UTSW 2 154311742 missense probably benign
R4755:Bpifb9b UTSW 2 154319694 missense probably benign 0.01
R4872:Bpifb9b UTSW 2 154313631 missense probably damaging 0.99
R4914:Bpifb9b UTSW 2 154314106 splice site probably null
R4915:Bpifb9b UTSW 2 154314106 splice site probably null
R4917:Bpifb9b UTSW 2 154314106 splice site probably null
R4918:Bpifb9b UTSW 2 154314106 splice site probably null
R4950:Bpifb9b UTSW 2 154311659 missense probably damaging 1.00
R5438:Bpifb9b UTSW 2 154309368 missense possibly damaging 0.65
R5507:Bpifb9b UTSW 2 154317027 missense possibly damaging 0.91
R6255:Bpifb9b UTSW 2 154309364 missense probably damaging 0.98
R7130:Bpifb9b UTSW 2 154311672 missense probably damaging 0.98
R7161:Bpifb9b UTSW 2 154313615 missense possibly damaging 0.95
R7736:Bpifb9b UTSW 2 154312105 missense probably benign 0.00
R8536:Bpifb9b UTSW 2 154316277 missense probably benign 0.00
R9348:Bpifb9b UTSW 2 154318846 missense probably benign 0.28
R9528:Bpifb9b UTSW 2 154311377 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAATTTGATGTGCTACCCAC -3'
(R):5'- TGATTGAACTCCTCCTAAGCTCAG -3'

Sequencing Primer
(F):5'- CTCTTCAGGTTTCAGCCACAAAGATG -3'
(R):5'- TCAGAATTGAGCAGCCCCTG -3'
Posted On 2022-01-20