Incidental Mutation 'R9134:Lrrc41'
ID 693825
Institutional Source Beutler Lab
Gene Symbol Lrrc41
Ensembl Gene ENSMUSG00000028703
Gene Name leucine rich repeat containing 41
Synonyms D730026A16Rik, MUF1, D630045E04Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.373) question?
Stock # R9134 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 116075269-116097043 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 116088585 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 166 (Q166K)
Ref Sequence ENSEMBL: ENSMUSP00000030471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030471]
AlphaFold Q8K1C9
Predicted Effect possibly damaging
Transcript: ENSMUST00000030471
AA Change: Q166K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030471
Gene: ENSMUSG00000028703
AA Change: Q166K

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 352 382 N/A INTRINSIC
low complexity region 417 429 N/A INTRINSIC
SCOP:d1yrga_ 449 742 4e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,199,232 V929A probably damaging Het
Ap1m1 A G 8: 72,240,069 probably benign Het
Arhgdia A T 11: 120,579,566 I122N probably damaging Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Atad5 G A 11: 80,133,105 R1681K probably benign Het
Bpifb9b T C 2: 154,309,521 V54A probably benign Het
Cby3 A C 11: 50,359,326 T25P probably damaging Het
Ccdc138 T G 10: 58,538,280 L374R probably damaging Het
Cd84 T A 1: 171,851,846 N30K probably damaging Het
Cdk20 T A 13: 64,433,092 probably null Het
Chd9 A G 8: 90,933,126 H238R unknown Het
Csl T A 10: 99,758,375 H276L probably damaging Het
Dchs1 A G 7: 105,755,703 L2544P probably damaging Het
Dnah17 T C 11: 118,088,146 T1807A probably damaging Het
Dph7 C T 2: 24,971,708 H378Y probably benign Het
Enkur T C 2: 21,180,968 I249V probably benign Het
Fam117a C A 11: 95,380,919 S439* probably null Het
Fam184a T G 10: 53,697,248 K345N probably damaging Het
Fam228a T C 12: 4,715,686 R255G probably benign Het
Fpr-rs7 A T 17: 20,114,063 M55K probably damaging Het
Frem2 A G 3: 53,654,900 Y729H probably damaging Het
Gm15448 T C 7: 3,822,183 S487G Het
Herc2 A G 7: 56,182,429 T2989A probably damaging Het
Hspb8 A G 5: 116,409,488 L145P probably damaging Het
Iars T A 13: 49,701,847 V250E probably benign Het
Ide G T 19: 37,296,162 probably benign Het
Ino80c T C 18: 24,121,708 S32G probably benign Het
Insr G A 8: 3,258,413 R208W probably damaging Het
Ints1 G A 5: 139,757,596 R1674W probably benign Het
Itsn1 G A 16: 91,869,626 V1153M unknown Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrriq3 T C 3: 155,114,546 probably null Het
Mndal T C 1: 173,871,530 I190V unknown Het
Nisch TCTGCTGC TCTGCTGCTGC 14: 31,174,680 probably benign Het
Nme4 G T 17: 26,095,415 A13E probably benign Het
Olfr1468-ps1 G T 19: 13,375,249 A96S probably damaging Het
Olfr292 C A 7: 86,695,380 S308* probably null Het
Olfr410 A G 11: 74,334,844 I129T probably damaging Het
Pcmt1 A T 10: 7,644,443 probably benign Het
Pde4c G T 8: 70,748,511 V493F probably damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prr23a1 T C 9: 98,842,882 L99P Het
Rex2 C G 4: 147,058,186 T377S probably benign Het
Robo2 A G 16: 73,906,850 F50L Het
Srgap1 A G 10: 122,047,222 probably benign Het
Syt3 A G 7: 44,393,367 N358D possibly damaging Het
Tfec T A 6: 16,835,327 T151S probably damaging Het
Tll1 A T 8: 64,016,167 I974N possibly damaging Het
Tmc2 T C 2: 130,232,401 V338A probably benign Het
Trappc6b T A 12: 59,050,374 D54V probably damaging Het
Trav6-2 T A 14: 52,667,652 C43* probably null Het
Ubr4 T A 4: 139,400,444 probably null Het
Vmn1r2 T A 4: 3,172,884 W268R probably damaging Het
Vmn2r120 A G 17: 57,525,093 L232S probably damaging Het
Vps26b T C 9: 27,009,929 T325A probably benign Het
Vwa3a T C 7: 120,778,436 V438A probably damaging Het
Wdcp C A 12: 4,851,533 S463* probably null Het
Xkr4 C T 1: 3,670,637 G238S probably benign Het
Zranb1 A G 7: 132,950,157 N179S probably benign Het
Other mutations in Lrrc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Lrrc41 APN 4 116096466 missense probably damaging 0.97
IGL01358:Lrrc41 APN 4 116075587 missense probably benign 0.16
IGL01734:Lrrc41 APN 4 116093134 critical splice donor site probably null
IGL01986:Lrrc41 APN 4 116089322 missense probably benign 0.27
IGL02159:Lrrc41 APN 4 116088486 missense probably benign 0.03
IGL02892:Lrrc41 APN 4 116088835 missense possibly damaging 0.68
IGL03135:Lrrc41 APN 4 116088531 missense probably benign
R1478:Lrrc41 UTSW 4 116095208 nonsense probably null
R1765:Lrrc41 UTSW 4 116089051 missense possibly damaging 0.94
R2233:Lrrc41 UTSW 4 116096385 missense possibly damaging 0.66
R4080:Lrrc41 UTSW 4 116080546 splice site probably null
R4677:Lrrc41 UTSW 4 116095135 missense probably benign
R4833:Lrrc41 UTSW 4 116093177 unclassified probably benign
R4877:Lrrc41 UTSW 4 116079405 missense probably damaging 0.99
R4926:Lrrc41 UTSW 4 116089324 missense possibly damaging 0.46
R6459:Lrrc41 UTSW 4 116088780 missense possibly damaging 0.95
R6817:Lrrc41 UTSW 4 116089305 missense possibly damaging 0.66
R6834:Lrrc41 UTSW 4 116096529 missense possibly damaging 0.46
R7479:Lrrc41 UTSW 4 116089041 missense probably damaging 0.96
R7512:Lrrc41 UTSW 4 116092994 missense possibly damaging 0.66
R7593:Lrrc41 UTSW 4 116092944 missense possibly damaging 0.94
R8006:Lrrc41 UTSW 4 116094888 missense possibly damaging 0.79
R8810:Lrrc41 UTSW 4 116075291 unclassified probably benign
R9495:Lrrc41 UTSW 4 116075609 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGGGCATTTGACAAATTTCTGG -3'
(R):5'- CCAGCACTCATGGTAAGAATAAG -3'

Sequencing Primer
(F):5'- GCATTTGACAAATTTCTGGTGTTTTC -3'
(R):5'- TAACAGCCCCATGGTGGATG -3'
Posted On 2022-01-20