Incidental Mutation 'R9134:Atad2b'
ID 693859
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9134 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5010351 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 915 (H915Q)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
AlphaFold E9Q166
Predicted Effect probably benign
Transcript: ENSMUST00000045664
AA Change: H915Q

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: H915Q

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,199,232 V929A probably damaging Het
Ap1m1 A G 8: 72,240,069 probably benign Het
Arhgdia A T 11: 120,579,566 I122N probably damaging Het
Atad5 G A 11: 80,133,105 R1681K probably benign Het
Bpifb9b T C 2: 154,309,521 V54A probably benign Het
Cby3 A C 11: 50,359,326 T25P probably damaging Het
Ccdc138 T G 10: 58,538,280 L374R probably damaging Het
Cd84 T A 1: 171,851,846 N30K probably damaging Het
Cdk20 T A 13: 64,433,092 probably null Het
Chd9 A G 8: 90,933,126 H238R unknown Het
Csl T A 10: 99,758,375 H276L probably damaging Het
Dchs1 A G 7: 105,755,703 L2544P probably damaging Het
Dnah17 T C 11: 118,088,146 T1807A probably damaging Het
Dph7 C T 2: 24,971,708 H378Y probably benign Het
Enkur T C 2: 21,180,968 I249V probably benign Het
Fam117a C A 11: 95,380,919 S439* probably null Het
Fam184a T G 10: 53,697,248 K345N probably damaging Het
Fam228a T C 12: 4,715,686 R255G probably benign Het
Fpr-rs7 A T 17: 20,114,063 M55K probably damaging Het
Frem2 A G 3: 53,654,900 Y729H probably damaging Het
Gm15448 T C 7: 3,822,183 S487G Het
Herc2 A G 7: 56,182,429 T2989A probably damaging Het
Hspb8 A G 5: 116,409,488 L145P probably damaging Het
Iars T A 13: 49,701,847 V250E probably benign Het
Ino80c T C 18: 24,121,708 S32G probably benign Het
Insr G A 8: 3,258,413 R208W probably damaging Het
Ints1 G A 5: 139,757,596 R1674W probably benign Het
Itsn1 G A 16: 91,869,626 V1153M unknown Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrrc41 C A 4: 116,088,585 Q166K possibly damaging Het
Lrriq3 T C 3: 155,114,546 probably null Het
Mndal T C 1: 173,871,530 I190V unknown Het
Nisch TCTGCTGC TCTGCTGCTGC 14: 31,174,680 probably benign Het
Nme4 G T 17: 26,095,415 A13E probably benign Het
Olfr1468-ps1 G T 19: 13,375,249 A96S probably damaging Het
Olfr292 C A 7: 86,695,380 S308* probably null Het
Olfr410 A G 11: 74,334,844 I129T probably damaging Het
Pde4c G T 8: 70,748,511 V493F probably damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prr23a1 T C 9: 98,842,882 L99P Het
Rex2 C G 4: 147,058,186 T377S probably benign Het
Robo2 A G 16: 73,906,850 F50L Het
Srgap1 A G 10: 122,047,222 probably benign Het
Syt3 A G 7: 44,393,367 N358D possibly damaging Het
Tfec T A 6: 16,835,327 T151S probably damaging Het
Tll1 A T 8: 64,016,167 I974N possibly damaging Het
Tmc2 T C 2: 130,232,401 V338A probably benign Het
Trappc6b T A 12: 59,050,374 D54V probably damaging Het
Trav6-2 T A 14: 52,667,652 C43* probably null Het
Ubr4 T A 4: 139,400,444 probably null Het
Vmn1r2 T A 4: 3,172,884 W268R probably damaging Het
Vmn2r120 A G 17: 57,525,093 L232S probably damaging Het
Vps26b T C 9: 27,009,929 T325A probably benign Het
Vwa3a T C 7: 120,778,436 V438A probably damaging Het
Wdcp C A 12: 4,851,533 S463* probably null Het
Xkr4 C T 1: 3,670,637 G238S probably benign Het
Zranb1 A G 7: 132,950,157 N179S probably benign Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTGCTTATTGAGAATGGGAC -3'
(R):5'- GGATTAGGTACACACAGCCATTTTC -3'

Sequencing Primer
(F):5'- AAGTACACTGTAGCTGTCGC -3'
(R):5'- CAATATGTCTATCTAGGCCAGGG -3'
Posted On 2022-01-20