Incidental Mutation 'R9134:Ino80c'
ID 693872
Institutional Source Beutler Lab
Gene Symbol Ino80c
Ensembl Gene ENSMUSG00000047989
Gene Name INO80 complex subunit C
Synonyms D030070L09Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.921) question?
Stock # R9134 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 24237818-24254876 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24254765 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 32 (S32G)
Ref Sequence ENSEMBL: ENSMUSP00000122372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055012] [ENSMUST00000141489] [ENSMUST00000153360]
AlphaFold Q8BHA0
Predicted Effect probably benign
Transcript: ENSMUST00000055012
AA Change: S32G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000055342
Gene: ENSMUSG00000047989
AA Change: S32G

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141489
AA Change: S32G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122372
Gene: ENSMUSG00000047989
AA Change: S32G

DomainStartEndE-ValueType
YL1_C 43 72 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153360
AA Change: S32G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114643
Gene: ENSMUSG00000047989
AA Change: S32G

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
YL1_C 140 169 2.99e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap1m1 A G 8: 72,993,913 (GRCm39) probably benign Het
Arhgdia A T 11: 120,470,392 (GRCm39) I122N probably damaging Het
Atad2b T A 12: 5,060,351 (GRCm39) H915Q probably benign Het
Atad5 G A 11: 80,023,931 (GRCm39) R1681K probably benign Het
Bpifb9b T C 2: 154,151,441 (GRCm39) V54A probably benign Het
Cby3 A C 11: 50,250,153 (GRCm39) T25P probably damaging Het
Ccdc138 T G 10: 58,374,102 (GRCm39) L374R probably damaging Het
Cd84 T A 1: 171,679,413 (GRCm39) N30K probably damaging Het
Cdk20 T A 13: 64,580,906 (GRCm39) probably null Het
Chd9 A G 8: 91,659,754 (GRCm39) H238R unknown Het
Cplane1 T C 15: 8,228,716 (GRCm39) V929A probably damaging Het
Csl T A 10: 99,594,237 (GRCm39) H276L probably damaging Het
Dchs1 A G 7: 105,404,910 (GRCm39) L2544P probably damaging Het
Dnah17 T C 11: 117,978,972 (GRCm39) T1807A probably damaging Het
Dph7 C T 2: 24,861,720 (GRCm39) H378Y probably benign Het
Enkur T C 2: 21,185,779 (GRCm39) I249V probably benign Het
Fam117a C A 11: 95,271,745 (GRCm39) S439* probably null Het
Fam184a T G 10: 53,573,344 (GRCm39) K345N probably damaging Het
Fam228a T C 12: 4,765,686 (GRCm39) R255G probably benign Het
Fpr-rs7 A T 17: 20,334,325 (GRCm39) M55K probably damaging Het
Frem2 A G 3: 53,562,321 (GRCm39) Y729H probably damaging Het
Herc2 A G 7: 55,832,177 (GRCm39) T2989A probably damaging Het
Hspb8 A G 5: 116,547,547 (GRCm39) L145P probably damaging Het
Iars1 T A 13: 49,855,323 (GRCm39) V250E probably benign Het
Ide G T 19: 37,273,561 (GRCm39) probably benign Het
Insr G A 8: 3,308,413 (GRCm39) R208W probably damaging Het
Ints1 G A 5: 139,743,351 (GRCm39) R1674W probably benign Het
Itsn1 G A 16: 91,666,514 (GRCm39) V1153M unknown Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lrrc41 C A 4: 115,945,782 (GRCm39) Q166K possibly damaging Het
Lrriq3 T C 3: 154,820,183 (GRCm39) probably null Het
Mndal T C 1: 173,699,096 (GRCm39) I190V unknown Het
Nisch TCTGCTGC TCTGCTGCTGC 14: 30,896,637 (GRCm39) probably benign Het
Nme4 G T 17: 26,314,389 (GRCm39) A13E probably benign Het
Or14c39 C A 7: 86,344,588 (GRCm39) S308* probably null Het
Or3a1 A G 11: 74,225,670 (GRCm39) I129T probably damaging Het
Or5b114-ps1 G T 19: 13,352,613 (GRCm39) A96S probably damaging Het
Pcmt1 A T 10: 7,520,207 (GRCm39) probably benign Het
Pde4c G T 8: 71,201,160 (GRCm39) V493F probably damaging Het
Pde8a C T 7: 80,982,619 (GRCm39) T746I probably damaging Het
Pira13 T C 7: 3,825,182 (GRCm39) S487G Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Prr23a1 T C 9: 98,724,935 (GRCm39) L99P Het
Rex2 C G 4: 147,142,643 (GRCm39) T377S probably benign Het
Robo2 A G 16: 73,703,738 (GRCm39) F50L Het
Srgap1 A G 10: 121,883,127 (GRCm39) probably benign Het
Syt3 A G 7: 44,042,791 (GRCm39) N358D possibly damaging Het
Tfec T A 6: 16,835,326 (GRCm39) T151S probably damaging Het
Tll1 A T 8: 64,469,201 (GRCm39) I974N possibly damaging Het
Tmc2 T C 2: 130,074,321 (GRCm39) V338A probably benign Het
Trappc6b T A 12: 59,097,160 (GRCm39) D54V probably damaging Het
Trav6-2 T A 14: 52,905,109 (GRCm39) C43* probably null Het
Ubr4 T A 4: 139,127,755 (GRCm39) probably null Het
Vmn1r2 T A 4: 3,172,884 (GRCm39) W268R probably damaging Het
Vmn2r120 A G 17: 57,832,093 (GRCm39) L232S probably damaging Het
Vps26b T C 9: 26,921,225 (GRCm39) T325A probably benign Het
Vwa3a T C 7: 120,377,659 (GRCm39) V438A probably damaging Het
Wdcp C A 12: 4,901,533 (GRCm39) S463* probably null Het
Xkr4 C T 1: 3,740,860 (GRCm39) G238S probably benign Het
Zranb1 A G 7: 132,551,886 (GRCm39) N179S probably benign Het
Other mutations in Ino80c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0063:Ino80c UTSW 18 24,239,681 (GRCm39) missense probably damaging 0.98
R2017:Ino80c UTSW 18 24,244,810 (GRCm39) nonsense probably null
R3800:Ino80c UTSW 18 24,254,752 (GRCm39) missense probably damaging 1.00
R4688:Ino80c UTSW 18 24,241,903 (GRCm39) missense probably damaging 1.00
R4711:Ino80c UTSW 18 24,247,222 (GRCm39) missense probably benign 0.00
R4966:Ino80c UTSW 18 24,239,702 (GRCm39) missense probably damaging 1.00
R5144:Ino80c UTSW 18 24,241,935 (GRCm39) missense probably benign 0.40
R5406:Ino80c UTSW 18 24,245,819 (GRCm39) missense probably benign 0.18
R6909:Ino80c UTSW 18 24,241,812 (GRCm39) intron probably benign
R7419:Ino80c UTSW 18 24,241,836 (GRCm39) missense unknown
R7470:Ino80c UTSW 18 24,241,895 (GRCm39) nonsense probably null
R8071:Ino80c UTSW 18 24,239,707 (GRCm39) missense unknown
R8936:Ino80c UTSW 18 24,254,865 (GRCm39) start gained probably benign
R9673:Ino80c UTSW 18 24,254,856 (GRCm39) start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- GCAGTATTTAGGACGTTGCCC -3'
(R):5'- TAACATCGAGCCGGAAGTTCTC -3'

Sequencing Primer
(F):5'- ATTTAGGACGTTGCCCGGAGAG -3'
(R):5'- AAGTTCTCGGGCTCGCCTTG -3'
Posted On 2022-01-20