Incidental Mutation 'R9134:Ino80c'
ID 693872
Institutional Source Beutler Lab
Gene Symbol Ino80c
Ensembl Gene ENSMUSG00000047989
Gene Name INO80 complex subunit C
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock # R9134 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 24104757-24121953 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24121708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 32 (S32G)
Ref Sequence ENSEMBL: ENSMUSP00000122372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055012] [ENSMUST00000141489] [ENSMUST00000153360]
AlphaFold Q8BHA0
Predicted Effect probably benign
Transcript: ENSMUST00000055012
AA Change: S32G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000055342
Gene: ENSMUSG00000047989
AA Change: S32G

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141489
AA Change: S32G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122372
Gene: ENSMUSG00000047989
AA Change: S32G

DomainStartEndE-ValueType
YL1_C 43 72 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153360
AA Change: S32G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114643
Gene: ENSMUSG00000047989
AA Change: S32G

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
YL1_C 140 169 2.99e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,199,232 V929A probably damaging Het
Ap1m1 A G 8: 72,240,069 probably benign Het
Arhgdia A T 11: 120,579,566 I122N probably damaging Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Atad5 G A 11: 80,133,105 R1681K probably benign Het
Bpifb9b T C 2: 154,309,521 V54A probably benign Het
Cby3 A C 11: 50,359,326 T25P probably damaging Het
Ccdc138 T G 10: 58,538,280 L374R probably damaging Het
Cd84 T A 1: 171,851,846 N30K probably damaging Het
Cdk20 T A 13: 64,433,092 probably null Het
Chd9 A G 8: 90,933,126 H238R unknown Het
Csl T A 10: 99,758,375 H276L probably damaging Het
Dchs1 A G 7: 105,755,703 L2544P probably damaging Het
Dnah17 T C 11: 118,088,146 T1807A probably damaging Het
Dph7 C T 2: 24,971,708 H378Y probably benign Het
Enkur T C 2: 21,180,968 I249V probably benign Het
Fam117a C A 11: 95,380,919 S439* probably null Het
Fam184a T G 10: 53,697,248 K345N probably damaging Het
Fam228a T C 12: 4,715,686 R255G probably benign Het
Fpr-rs7 A T 17: 20,114,063 M55K probably damaging Het
Frem2 A G 3: 53,654,900 Y729H probably damaging Het
Gm15448 T C 7: 3,822,183 S487G Het
Herc2 A G 7: 56,182,429 T2989A probably damaging Het
Hspb8 A G 5: 116,409,488 L145P probably damaging Het
Iars T A 13: 49,701,847 V250E probably benign Het
Ide G T 19: 37,296,162 probably benign Het
Insr G A 8: 3,258,413 R208W probably damaging Het
Ints1 G A 5: 139,757,596 R1674W probably benign Het
Itsn1 G A 16: 91,869,626 V1153M unknown Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrrc41 C A 4: 116,088,585 Q166K possibly damaging Het
Lrriq3 T C 3: 155,114,546 probably null Het
Mndal T C 1: 173,871,530 I190V unknown Het
Nisch TCTGCTGC TCTGCTGCTGC 14: 31,174,680 probably benign Het
Nme4 G T 17: 26,095,415 A13E probably benign Het
Olfr1468-ps1 G T 19: 13,375,249 A96S probably damaging Het
Olfr292 C A 7: 86,695,380 S308* probably null Het
Olfr410 A G 11: 74,334,844 I129T probably damaging Het
Pcmt1 A T 10: 7,644,443 probably benign Het
Pde4c G T 8: 70,748,511 V493F probably damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prr23a1 T C 9: 98,842,882 L99P Het
Rex2 C G 4: 147,058,186 T377S probably benign Het
Robo2 A G 16: 73,906,850 F50L Het
Srgap1 A G 10: 122,047,222 probably benign Het
Syt3 A G 7: 44,393,367 N358D possibly damaging Het
Tfec T A 6: 16,835,327 T151S probably damaging Het
Tll1 A T 8: 64,016,167 I974N possibly damaging Het
Tmc2 T C 2: 130,232,401 V338A probably benign Het
Trappc6b T A 12: 59,050,374 D54V probably damaging Het
Trav6-2 T A 14: 52,667,652 C43* probably null Het
Ubr4 T A 4: 139,400,444 probably null Het
Vmn1r2 T A 4: 3,172,884 W268R probably damaging Het
Vmn2r120 A G 17: 57,525,093 L232S probably damaging Het
Vps26b T C 9: 27,009,929 T325A probably benign Het
Vwa3a T C 7: 120,778,436 V438A probably damaging Het
Wdcp C A 12: 4,851,533 S463* probably null Het
Xkr4 C T 1: 3,670,637 G238S probably benign Het
Zranb1 A G 7: 132,950,157 N179S probably benign Het
Other mutations in Ino80c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0063:Ino80c UTSW 18 24106624 missense probably damaging 0.98
R2017:Ino80c UTSW 18 24111753 nonsense probably null
R3800:Ino80c UTSW 18 24121695 missense probably damaging 1.00
R4688:Ino80c UTSW 18 24108846 missense probably damaging 1.00
R4711:Ino80c UTSW 18 24114165 missense probably benign 0.00
R4966:Ino80c UTSW 18 24106645 missense probably damaging 1.00
R5144:Ino80c UTSW 18 24108878 missense probably benign 0.40
R5406:Ino80c UTSW 18 24112762 missense probably benign 0.18
R6909:Ino80c UTSW 18 24108755 intron probably benign
R7419:Ino80c UTSW 18 24108779 missense unknown
R7470:Ino80c UTSW 18 24108838 nonsense probably null
R8071:Ino80c UTSW 18 24106650 missense unknown
R8936:Ino80c UTSW 18 24121808 start gained probably benign
R9673:Ino80c UTSW 18 24121799 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- GCAGTATTTAGGACGTTGCCC -3'
(R):5'- TAACATCGAGCCGGAAGTTCTC -3'

Sequencing Primer
(F):5'- ATTTAGGACGTTGCCCGGAGAG -3'
(R):5'- AAGTTCTCGGGCTCGCCTTG -3'
Posted On 2022-01-20