Incidental Mutation 'R9135:Il18rap'
ID 693875
Institutional Source Beutler Lab
Gene Symbol Il18rap
Ensembl Gene ENSMUSG00000026068
Gene Name interleukin 18 receptor accessory protein
Synonyms AcPL accessory protein-like)
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9135 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 40515362-40551705 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 40543017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 366 (T366M)
Ref Sequence ENSEMBL: ENSMUSP00000027237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027237]
AlphaFold Q9Z2B1
Predicted Effect probably benign
Transcript: ENSMUST00000027237
AA Change: T366M

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027237
Gene: ENSMUSG00000026068
AA Change: T366M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:IG_like 31 144 2e-36 BLAST
IG 159 240 2.94e0 SMART
IG 257 354 1.35e0 SMART
transmembrane domain 363 385 N/A INTRINSIC
TIR 406 561 3.68e-35 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Interleukin-18 (or interferon-gamma inducing factor) is a proinflammatory cytokine that induces cell-mediated immunity following microbial infection. This gene encodes a member of the interleukin-1 receptor family. The encoded protein is an accessory subunit of the receptor for interleukin-18 and mediates signaling through this cytokine. Mice lacking this gene exhibit a defective cell-mediated immune response. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice exhibit defective IL-18-mediated immune responses such as the inability of splenocytes, T helper 1 cells and neutrophils to produce cytokines in response to IL-18. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,404 L513Q probably damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abi3bp A G 16: 56,596,810 D419G probably benign Het
Acoxl A T 2: 127,854,771 probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Adgra2 T C 8: 27,120,951 L976P probably damaging Het
Adora2b A G 11: 62,265,060 probably null Het
Ak1 A T 2: 32,631,170 Q117L probably damaging Het
Akr1c14 T A 13: 4,078,029 D143E probably damaging Het
Ap4e1 A T 2: 127,019,322 H127L probably damaging Het
Asxl3 T A 18: 22,516,613 I553N probably damaging Het
Asxl3 T A 18: 22,524,424 N1830K possibly damaging Het
Atp11a G A 8: 12,813,144 A108T probably damaging Het
Bag6 A G 17: 35,143,461 T582A unknown Het
Bbs9 T C 9: 22,578,709 S259P probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Blvrb T C 7: 27,465,785 S177P probably damaging Het
C1s2 T A 6: 124,625,683 D523V probably benign Het
Cacna2d1 C T 5: 16,353,852 T736I probably damaging Het
Card9 T C 2: 26,352,385 N513S probably benign Het
Casp2 A G 6: 42,268,948 T180A probably benign Het
Cenpf A T 1: 189,672,549 L361Q probably damaging Het
Cnbd2 T C 2: 156,375,568 I659T probably damaging Het
Cped1 A T 6: 21,987,013 D68V probably damaging Het
Cxcr1 T C 1: 74,191,940 I308V probably benign Het
Dad1 A G 14: 54,253,706 L46P probably damaging Het
Defb23 G A 2: 152,459,502 A50V probably benign Het
Dhx33 C T 11: 70,987,166 A684T probably damaging Het
Epb41l4a T A 18: 33,832,676 N366I probably benign Het
Erich3 A G 3: 154,762,275 E788G Het
Fam241b T C 10: 62,109,113 N35S probably benign Het
Fbxo24 T A 5: 137,624,264 Q80L probably benign Het
Foxk1 T G 5: 142,448,742 F254V probably benign Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm12886 T C 4: 121,417,546 I46V probably benign Het
Gm20834 G T Y: 10,323,354 H27Q probably damaging Het
Gm2888 A G 14: 3,032,106 N138S probably damaging Het
Gm5773 T C 3: 93,773,872 C284R possibly damaging Het
Gprin3 A T 6: 59,353,288 M678K probably benign Het
Grm7 T C 6: 111,495,768 V856A probably benign Het
Immt C T 6: 71,874,419 T588I probably damaging Het
Ints1 G C 5: 139,751,946 N2145K possibly damaging Het
Jade2 T C 11: 51,825,124 D418G probably benign Het
Kdf1 T C 4: 133,528,829 Y286H probably damaging Het
Kif18a A G 2: 109,341,161 Y861C possibly damaging Het
Lama2 T A 10: 27,422,519 I194F probably damaging Het
Lhx8 A G 3: 154,328,426 S33P probably benign Het
Lmo7 T C 14: 101,880,861 I174T probably damaging Het
Lrfn2 A T 17: 49,069,948 D19V possibly damaging Het
Lrrk1 A T 7: 66,278,609 I1257N probably damaging Het
Malrd1 T A 2: 15,797,705 H1076Q unknown Het
Map3k14 A C 11: 103,237,538 M419R probably damaging Het
Mcm10 G A 2: 5,006,561 R200C probably benign Het
Mertk A G 2: 128,762,115 N390D probably benign Het
Mitf T A 6: 98,013,719 I361N probably damaging Het
Mrgprb1 T A 7: 48,447,298 I289F possibly damaging Het
Muc5ac A T 7: 141,798,481 D659V probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nphp3 T G 9: 104,032,015 L808R probably damaging Het
Olfr1434 T A 19: 12,283,444 L132Q probably damaging Het
Olfr1467 T A 19: 13,365,391 S254R possibly damaging Het
Olfr20 T C 11: 73,354,490 S246P probably damaging Het
Olfr296-ps1 G A 7: 86,561,948 C72Y unknown Het
Pagr1a T C 7: 127,016,782 E47G probably benign Het
Papss2 G T 19: 32,641,364 R274L probably damaging Het
Pcdhga10 C A 18: 37,747,907 F240L probably damaging Het
Pcsk5 T G 19: 17,586,108 E555A Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pgrmc2 T A 3: 41,068,664 D206V probably damaging Het
Pkd1 T C 17: 24,572,002 V1057A Het
Plekha5 T C 6: 140,534,513 I113T probably damaging Het
Prss32 C T 17: 23,859,225 T295I possibly damaging Het
Ptprk G T 10: 28,580,417 V1072F probably damaging Het
Rasd2 T A 8: 75,218,546 M1K probably null Het
Rhag T A 17: 40,828,411 M79K probably damaging Het
Rnf19a C A 15: 36,253,164 probably null Het
Rnf213 G T 11: 119,408,747 G101C Het
Sap130 T A 18: 31,647,063 D45E probably benign Het
Scel T A 14: 103,602,190 F510I probably benign Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Shoc2 T A 19: 53,987,879 S67T probably benign Het
Slc22a3 T C 17: 12,426,732 I441V possibly damaging Het
Slfn5 A G 11: 82,960,677 D600G probably benign Het
Smim7 G A 8: 72,570,913 T10M probably damaging Het
Sntb2 A T 8: 106,936,199 Q133L possibly damaging Het
Steap3 A C 1: 120,234,318 M408R probably benign Het
Supt4a T C 11: 87,742,798 I60T probably benign Het
Swt1 A C 1: 151,368,488 C899G possibly damaging Het
Taok3 A G 5: 117,206,679 E157G probably damaging Het
Taok3 T C 5: 117,241,103 V401A probably benign Het
Taok3 C T 5: 117,241,180 L427F possibly damaging Het
Tcf25 A G 8: 123,381,443 E79G probably benign Het
Tigit G A 16: 43,659,513 L140F possibly damaging Het
Tmem143 G T 7: 45,897,378 probably benign Het
Tmem151b C T 17: 45,545,429 V362M possibly damaging Het
Tmem230 A G 2: 132,244,069 F58L probably benign Het
Trim25 T C 11: 89,009,162 M245T probably benign Het
Trim36 A C 18: 46,169,343 V546G probably benign Het
Triml1 T C 8: 43,130,587 N326D probably damaging Het
Trp53bp2 T C 1: 182,458,763 V1056A probably damaging Het
Trpa1 C A 1: 14,882,211 M865I probably damaging Het
Ttbk1 A T 17: 46,479,206 Y104* probably null Het
Tubg1 T A 11: 101,123,431 H139Q probably damaging Het
Ufsp2 A G 8: 45,994,013 probably null Het
Uhrf1bp1 T A 17: 27,885,928 L532* probably null Het
Usp47 A T 7: 112,053,224 N36I probably benign Het
Vmn1r32 G A 6: 66,553,136 R219* probably null Het
Vmn2r59 G A 7: 42,043,701 P492S probably benign Het
Vmn2r59 G C 7: 42,043,703 A491G Het
Wdr63 T C 3: 146,066,834 T486A probably benign Het
Wdr76 T C 2: 121,534,111 Y299H probably damaging Het
Wnt5a C T 14: 28,518,352 A153V probably benign Het
Zfp202 T C 9: 40,208,941 V226A possibly damaging Het
Zfp219 C T 14: 52,007,141 R527H probably damaging Het
Zfp408 A T 2: 91,645,183 L542H probably damaging Het
Zfyve9 A T 4: 108,682,189 C271* probably null Het
Other mutations in Il18rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Il18rap APN 1 40541921 missense probably benign 0.03
IGL01467:Il18rap APN 1 40548639 missense probably damaging 1.00
IGL01505:Il18rap APN 1 40537084 missense probably damaging 0.97
IGL02215:Il18rap APN 1 40547922 missense probably damaging 1.00
IGL03307:Il18rap APN 1 40543067 missense probably benign 0.01
BB006:Il18rap UTSW 1 40531580 missense probably damaging 1.00
BB007:Il18rap UTSW 1 40548643 missense probably damaging 0.99
BB016:Il18rap UTSW 1 40531580 missense probably damaging 1.00
BB017:Il18rap UTSW 1 40548643 missense probably damaging 0.99
R0136:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0299:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0358:Il18rap UTSW 1 40549042 missense possibly damaging 0.53
R0499:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0830:Il18rap UTSW 1 40542990 missense probably damaging 1.00
R1386:Il18rap UTSW 1 40531522 missense probably benign 0.00
R1817:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1818:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1819:Il18rap UTSW 1 40531527 missense probably benign 0.04
R3721:Il18rap UTSW 1 40537088 missense probably damaging 1.00
R5634:Il18rap UTSW 1 40539376 intron probably benign
R5663:Il18rap UTSW 1 40531557 missense probably damaging 1.00
R5690:Il18rap UTSW 1 40537112 missense possibly damaging 0.73
R5825:Il18rap UTSW 1 40531566 missense probably benign 0.38
R6140:Il18rap UTSW 1 40525052 missense probably benign 0.04
R6291:Il18rap UTSW 1 40524889 missense probably benign 0.00
R6859:Il18rap UTSW 1 40525095 nonsense probably null
R6992:Il18rap UTSW 1 40542035 missense probably benign 0.00
R7317:Il18rap UTSW 1 40525376 missense probably damaging 0.98
R7402:Il18rap UTSW 1 40524951 missense probably benign 0.01
R7465:Il18rap UTSW 1 40543089 missense probably damaging 1.00
R7561:Il18rap UTSW 1 40524377 missense probably benign 0.00
R7929:Il18rap UTSW 1 40531580 missense probably damaging 1.00
R7930:Il18rap UTSW 1 40548643 missense probably damaging 0.99
R8151:Il18rap UTSW 1 40525268 missense probably benign 0.00
R8201:Il18rap UTSW 1 40539269 missense possibly damaging 0.75
R8356:Il18rap UTSW 1 40524924 missense probably benign 0.28
R8701:Il18rap UTSW 1 40539341 missense probably benign 0.01
R8870:Il18rap UTSW 1 40525120 splice site probably benign
R8874:Il18rap UTSW 1 40525346 missense probably damaging 1.00
R8911:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8912:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8913:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8914:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8958:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8959:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9024:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9136:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9137:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9138:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9194:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9197:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9198:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9200:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9201:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9218:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9353:Il18rap UTSW 1 40547928 missense probably benign 0.02
R9465:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9466:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9535:Il18rap UTSW 1 40547830 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATTTCCCATCAACCTGGCTC -3'
(R):5'- ACTTTTCTCATGGGCTCTGG -3'

Sequencing Primer
(F):5'- CAACCTGGCTCTCTAGAGTTAATTG -3'
(R):5'- GCAGGAGGCATGTGAAATCAC -3'
Posted On 2022-01-20