Incidental Mutation 'R9135:Mertk'
ID 693892
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Name c-mer proto-oncogene tyrosine kinase
Synonyms Nyk, nmf12, Tyro 12, Eyk, Mer
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock # R9135 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128698956-128802894 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128762115 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 390 (N390D)
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505]
AlphaFold Q60805
Predicted Effect probably benign
Transcript: ENSMUST00000014505
AA Change: N390D

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: N390D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,404 L513Q probably damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abi3bp A G 16: 56,596,810 D419G probably benign Het
Acoxl A T 2: 127,854,771 probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Adgra2 T C 8: 27,120,951 L976P probably damaging Het
Adora2b A G 11: 62,265,060 probably null Het
Ak1 A T 2: 32,631,170 Q117L probably damaging Het
Akr1c14 T A 13: 4,078,029 D143E probably damaging Het
Ap4e1 A T 2: 127,019,322 H127L probably damaging Het
Asxl3 T A 18: 22,516,613 I553N probably damaging Het
Asxl3 T A 18: 22,524,424 N1830K possibly damaging Het
Atp11a G A 8: 12,813,144 A108T probably damaging Het
Bag6 A G 17: 35,143,461 T582A unknown Het
Bbs9 T C 9: 22,578,709 S259P probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Blvrb T C 7: 27,465,785 S177P probably damaging Het
C1s2 T A 6: 124,625,683 D523V probably benign Het
Cacna2d1 C T 5: 16,353,852 T736I probably damaging Het
Card9 T C 2: 26,352,385 N513S probably benign Het
Casp2 A G 6: 42,268,948 T180A probably benign Het
Cenpf A T 1: 189,672,549 L361Q probably damaging Het
Cnbd2 T C 2: 156,375,568 I659T probably damaging Het
Cped1 A T 6: 21,987,013 D68V probably damaging Het
Cxcr1 T C 1: 74,191,940 I308V probably benign Het
Dad1 A G 14: 54,253,706 L46P probably damaging Het
Defb23 G A 2: 152,459,502 A50V probably benign Het
Dhx33 C T 11: 70,987,166 A684T probably damaging Het
Epb41l4a T A 18: 33,832,676 N366I probably benign Het
Erich3 A G 3: 154,762,275 E788G Het
Fam241b T C 10: 62,109,113 N35S probably benign Het
Fbxo24 T A 5: 137,624,264 Q80L probably benign Het
Foxk1 T G 5: 142,448,742 F254V probably benign Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm12886 T C 4: 121,417,546 I46V probably benign Het
Gm20834 G T Y: 10,323,354 H27Q probably damaging Het
Gm2888 A G 14: 3,032,106 N138S probably damaging Het
Gm5773 T C 3: 93,773,872 C284R possibly damaging Het
Gprin3 A T 6: 59,353,288 M678K probably benign Het
Grm7 T C 6: 111,495,768 V856A probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Immt C T 6: 71,874,419 T588I probably damaging Het
Ints1 G C 5: 139,751,946 N2145K possibly damaging Het
Jade2 T C 11: 51,825,124 D418G probably benign Het
Kdf1 T C 4: 133,528,829 Y286H probably damaging Het
Kif18a A G 2: 109,341,161 Y861C possibly damaging Het
Lama2 T A 10: 27,422,519 I194F probably damaging Het
Lhx8 A G 3: 154,328,426 S33P probably benign Het
Lmo7 T C 14: 101,880,861 I174T probably damaging Het
Lrfn2 A T 17: 49,069,948 D19V possibly damaging Het
Lrrk1 A T 7: 66,278,609 I1257N probably damaging Het
Malrd1 T A 2: 15,797,705 H1076Q unknown Het
Map3k14 A C 11: 103,237,538 M419R probably damaging Het
Mcm10 G A 2: 5,006,561 R200C probably benign Het
Mitf T A 6: 98,013,719 I361N probably damaging Het
Mrgprb1 T A 7: 48,447,298 I289F possibly damaging Het
Muc5ac A T 7: 141,798,481 D659V probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nphp3 T G 9: 104,032,015 L808R probably damaging Het
Olfr1434 T A 19: 12,283,444 L132Q probably damaging Het
Olfr1467 T A 19: 13,365,391 S254R possibly damaging Het
Olfr20 T C 11: 73,354,490 S246P probably damaging Het
Olfr296-ps1 G A 7: 86,561,948 C72Y unknown Het
Pagr1a T C 7: 127,016,782 E47G probably benign Het
Papss2 G T 19: 32,641,364 R274L probably damaging Het
Pcdhga10 C A 18: 37,747,907 F240L probably damaging Het
Pcsk5 T G 19: 17,586,108 E555A Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pgrmc2 T A 3: 41,068,664 D206V probably damaging Het
Pkd1 T C 17: 24,572,002 V1057A Het
Plekha5 T C 6: 140,534,513 I113T probably damaging Het
Prss32 C T 17: 23,859,225 T295I possibly damaging Het
Ptprk G T 10: 28,580,417 V1072F probably damaging Het
Rasd2 T A 8: 75,218,546 M1K probably null Het
Rhag T A 17: 40,828,411 M79K probably damaging Het
Rnf19a C A 15: 36,253,164 probably null Het
Rnf213 G T 11: 119,408,747 G101C Het
Sap130 T A 18: 31,647,063 D45E probably benign Het
Scel T A 14: 103,602,190 F510I probably benign Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Shoc2 T A 19: 53,987,879 S67T probably benign Het
Slc22a3 T C 17: 12,426,732 I441V possibly damaging Het
Slfn5 A G 11: 82,960,677 D600G probably benign Het
Smim7 G A 8: 72,570,913 T10M probably damaging Het
Sntb2 A T 8: 106,936,199 Q133L possibly damaging Het
Steap3 A C 1: 120,234,318 M408R probably benign Het
Supt4a T C 11: 87,742,798 I60T probably benign Het
Swt1 A C 1: 151,368,488 C899G possibly damaging Het
Taok3 A G 5: 117,206,679 E157G probably damaging Het
Taok3 T C 5: 117,241,103 V401A probably benign Het
Taok3 C T 5: 117,241,180 L427F possibly damaging Het
Tcf25 A G 8: 123,381,443 E79G probably benign Het
Tigit G A 16: 43,659,513 L140F possibly damaging Het
Tmem143 G T 7: 45,897,378 probably benign Het
Tmem151b C T 17: 45,545,429 V362M possibly damaging Het
Tmem230 A G 2: 132,244,069 F58L probably benign Het
Trim25 T C 11: 89,009,162 M245T probably benign Het
Trim36 A C 18: 46,169,343 V546G probably benign Het
Triml1 T C 8: 43,130,587 N326D probably damaging Het
Trp53bp2 T C 1: 182,458,763 V1056A probably damaging Het
Trpa1 C A 1: 14,882,211 M865I probably damaging Het
Ttbk1 A T 17: 46,479,206 Y104* probably null Het
Tubg1 T A 11: 101,123,431 H139Q probably damaging Het
Ufsp2 A G 8: 45,994,013 probably null Het
Uhrf1bp1 T A 17: 27,885,928 L532* probably null Het
Usp47 A T 7: 112,053,224 N36I probably benign Het
Vmn1r32 G A 6: 66,553,136 R219* probably null Het
Vmn2r59 G A 7: 42,043,701 P492S probably benign Het
Vmn2r59 G C 7: 42,043,703 A491G Het
Wdr63 T C 3: 146,066,834 T486A probably benign Het
Wdr76 T C 2: 121,534,111 Y299H probably damaging Het
Wnt5a C T 14: 28,518,352 A153V probably benign Het
Zfp202 T C 9: 40,208,941 V226A possibly damaging Het
Zfp219 C T 14: 52,007,141 R527H probably damaging Het
Zfp408 A T 2: 91,645,183 L542H probably damaging Het
Zfyve9 A T 4: 108,682,189 C271* probably null Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R0628:Mertk UTSW 2 128738313 missense probably damaging 1.00
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4664:Mertk UTSW 2 128801212 missense probably benign 0.24
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R5987:Mertk UTSW 2 128771374 missense probably benign 0.01
R6127:Mertk UTSW 2 128738291 missense probably damaging 0.99
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6671:Mertk UTSW 2 128752023 critical splice donor site probably null
R6674:Mertk UTSW 2 128729357 missense probably benign
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
R7883:Mertk UTSW 2 128776345 missense probably benign 0.01
R8000:Mertk UTSW 2 128771498 missense probably benign
R8953:Mertk UTSW 2 128778796 intron probably benign
R9153:Mertk UTSW 2 128782567 missense probably damaging 1.00
R9176:Mertk UTSW 2 128778972 missense possibly damaging 0.62
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCTAAGAGGATAGGAGTTTACC -3'
(R):5'- GCCTTGCCTTGCTCAATGATAAC -3'

Sequencing Primer
(F):5'- AGGAGTTTACCATTAATCTGGGTC -3'
(R):5'- GCCTTGCTCAATGATAACAAGTGAC -3'
Posted On 2022-01-20