Incidental Mutation 'R9135:Erich3'
ID 693900
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Name glutamate rich 3
Synonyms 5031409G23Rik, 4922501L14Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9135 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 154416770-154454649 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 154467912 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 788 (E788G)
Ref Sequence ENSEMBL: ENSMUSP00000096097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098496] [ENSMUST00000189969]
AlphaFold F6QRE9
Predicted Effect
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: E788G

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189969
SMART Domains Protein: ENSMUSP00000140929
Gene: ENSMUSG00000078161

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Abi3bp A G 16: 56,417,173 (GRCm39) D419G probably benign Het
Acoxl A T 2: 127,696,691 (GRCm39) probably benign Het
Acvr1 T C 2: 58,352,983 (GRCm39) T326A possibly damaging Het
Adgra2 T C 8: 27,610,979 (GRCm39) L976P probably damaging Het
Adora2b A G 11: 62,155,886 (GRCm39) probably null Het
Ak1 A T 2: 32,521,182 (GRCm39) Q117L probably damaging Het
Akr1c14 T A 13: 4,128,029 (GRCm39) D143E probably damaging Het
Ap4e1 A T 2: 126,861,242 (GRCm39) H127L probably damaging Het
Asxl3 T A 18: 22,649,670 (GRCm39) I553N probably damaging Het
Asxl3 T A 18: 22,657,481 (GRCm39) N1830K possibly damaging Het
Atp11a G A 8: 12,863,144 (GRCm39) A108T probably damaging Het
Bag6 A G 17: 35,362,437 (GRCm39) T582A unknown Het
Bbs9 T C 9: 22,490,005 (GRCm39) S259P probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Bltp3a T A 17: 28,104,902 (GRCm39) L532* probably null Het
Blvrb T C 7: 27,165,210 (GRCm39) S177P probably damaging Het
C1s2 T A 6: 124,602,642 (GRCm39) D523V probably benign Het
Cacna2d1 C T 5: 16,558,850 (GRCm39) T736I probably damaging Het
Card9 T C 2: 26,242,397 (GRCm39) N513S probably benign Het
Casp2 A G 6: 42,245,882 (GRCm39) T180A probably benign Het
Cenpf A T 1: 189,404,746 (GRCm39) L361Q probably damaging Het
Cnbd2 T C 2: 156,217,488 (GRCm39) I659T probably damaging Het
Cped1 A T 6: 21,987,012 (GRCm39) D68V probably damaging Het
Cxcr1 T C 1: 74,231,099 (GRCm39) I308V probably benign Het
Dad1 A G 14: 54,491,163 (GRCm39) L46P probably damaging Het
Defb23 G A 2: 152,301,422 (GRCm39) A50V probably benign Het
Dhx33 C T 11: 70,877,992 (GRCm39) A684T probably damaging Het
Dnai3 T C 3: 145,772,589 (GRCm39) T486A probably benign Het
Epb41l4a T A 18: 33,965,729 (GRCm39) N366I probably benign Het
Fam241b T C 10: 61,944,892 (GRCm39) N35S probably benign Het
Fbxo24 T A 5: 137,622,526 (GRCm39) Q80L probably benign Het
Foxk1 T G 5: 142,434,497 (GRCm39) F254V probably benign Het
Gm10801 C CGTG 2: 98,494,152 (GRCm39) probably null Het
Gm12886 T C 4: 121,274,743 (GRCm39) I46V probably benign Het
Gm20834 G T Y: 10,323,354 (GRCm39) H27Q probably damaging Het
Gm2888 A G 14: 3,032,106 (GRCm38) N138S probably damaging Het
Gm5773 T C 3: 93,681,179 (GRCm39) C284R possibly damaging Het
Gprin3 A T 6: 59,330,273 (GRCm39) M678K probably benign Het
Grm7 T C 6: 111,472,729 (GRCm39) V856A probably benign Het
Il18rap C T 1: 40,582,177 (GRCm39) T366M probably benign Het
Immt C T 6: 71,851,403 (GRCm39) T588I probably damaging Het
Ints1 G C 5: 139,737,701 (GRCm39) N2145K possibly damaging Het
Jade2 T C 11: 51,715,951 (GRCm39) D418G probably benign Het
Kdf1 T C 4: 133,256,140 (GRCm39) Y286H probably damaging Het
Kif18a A G 2: 109,171,506 (GRCm39) Y861C possibly damaging Het
Lama2 T A 10: 27,298,515 (GRCm39) I194F probably damaging Het
Lhx8 A G 3: 154,034,063 (GRCm39) S33P probably benign Het
Lmo7 T C 14: 102,118,297 (GRCm39) I174T probably damaging Het
Lrfn2 A T 17: 49,376,976 (GRCm39) D19V possibly damaging Het
Lrrk1 A T 7: 65,928,357 (GRCm39) I1257N probably damaging Het
Malrd1 T A 2: 15,802,516 (GRCm39) H1076Q unknown Het
Map3k14 A C 11: 103,128,364 (GRCm39) M419R probably damaging Het
Mcm10 G A 2: 5,011,372 (GRCm39) R200C probably benign Het
Mertk A G 2: 128,604,035 (GRCm39) N390D probably benign Het
Mitf T A 6: 97,990,680 (GRCm39) I361N probably damaging Het
Mrgprb1 T A 7: 48,097,046 (GRCm39) I289F possibly damaging Het
Muc5ac A T 7: 141,352,218 (GRCm39) D659V probably damaging Het
Nox4 G A 7: 87,025,448 (GRCm39) R525Q probably benign Het
Nphp3 T G 9: 103,909,214 (GRCm39) L808R probably damaging Het
Or14c42-ps1 G A 7: 86,211,156 (GRCm39) C72Y unknown Het
Or1e1 T C 11: 73,245,316 (GRCm39) S246P probably damaging Het
Or5an1 T A 19: 12,260,808 (GRCm39) L132Q probably damaging Het
Or5b113 T A 19: 13,342,755 (GRCm39) S254R possibly damaging Het
Pagr1a T C 7: 126,615,954 (GRCm39) E47G probably benign Het
Papss2 G T 19: 32,618,764 (GRCm39) R274L probably damaging Het
Pcdhga10 C A 18: 37,880,960 (GRCm39) F240L probably damaging Het
Pcsk5 T G 19: 17,563,472 (GRCm39) E555A Het
Peg10 C CTCA 6: 4,756,453 (GRCm39) probably benign Het
Pgrmc2 T A 3: 41,023,099 (GRCm39) D206V probably damaging Het
Pkd1 T C 17: 24,790,976 (GRCm39) V1057A Het
Plekha5 T C 6: 140,480,239 (GRCm39) I113T probably damaging Het
Prorp T A 12: 55,426,189 (GRCm39) L513Q probably damaging Het
Prss32 C T 17: 24,078,199 (GRCm39) T295I possibly damaging Het
Ptprk G T 10: 28,456,413 (GRCm39) V1072F probably damaging Het
Rasd2 T A 8: 75,945,174 (GRCm39) M1K probably null Het
Rhag T A 17: 41,139,302 (GRCm39) M79K probably damaging Het
Rnf19a C A 15: 36,253,310 (GRCm39) probably null Het
Rnf213 G T 11: 119,299,573 (GRCm39) G101C Het
Sap130 T A 18: 31,780,116 (GRCm39) D45E probably benign Het
Scel T A 14: 103,839,626 (GRCm39) F510I probably benign Het
Sertad2 A T 11: 20,598,425 (GRCm39) E207V probably benign Het
Shoc2 T A 19: 53,976,310 (GRCm39) S67T probably benign Het
Slc22a3 T C 17: 12,645,619 (GRCm39) I441V possibly damaging Het
Slfn5 A G 11: 82,851,503 (GRCm39) D600G probably benign Het
Smim7 G A 8: 73,324,757 (GRCm39) T10M probably damaging Het
Sntb2 A T 8: 107,662,831 (GRCm39) Q133L possibly damaging Het
Steap3 A C 1: 120,162,048 (GRCm39) M408R probably benign Het
Supt4a T C 11: 87,633,624 (GRCm39) I60T probably benign Het
Swt1 A C 1: 151,244,239 (GRCm39) C899G possibly damaging Het
Taok3 A G 5: 117,344,744 (GRCm39) E157G probably damaging Het
Taok3 C T 5: 117,379,245 (GRCm39) L427F possibly damaging Het
Taok3 T C 5: 117,379,168 (GRCm39) V401A probably benign Het
Tcf25 A G 8: 124,108,182 (GRCm39) E79G probably benign Het
Tigit G A 16: 43,479,876 (GRCm39) L140F possibly damaging Het
Tmem143 G T 7: 45,546,802 (GRCm39) probably benign Het
Tmem151b C T 17: 45,856,355 (GRCm39) V362M possibly damaging Het
Tmem230 A G 2: 132,085,989 (GRCm39) F58L probably benign Het
Trim25 T C 11: 88,899,988 (GRCm39) M245T probably benign Het
Trim36 A C 18: 46,302,410 (GRCm39) V546G probably benign Het
Triml1 T C 8: 43,583,624 (GRCm39) N326D probably damaging Het
Trp53bp2 T C 1: 182,286,328 (GRCm39) V1056A probably damaging Het
Trpa1 C A 1: 14,952,435 (GRCm39) M865I probably damaging Het
Ttbk1 A T 17: 46,790,132 (GRCm39) Y104* probably null Het
Tubg1 T A 11: 101,014,257 (GRCm39) H139Q probably damaging Het
Ufsp2 A G 8: 46,447,050 (GRCm39) probably null Het
Usp47 A T 7: 111,652,431 (GRCm39) N36I probably benign Het
Vmn1r32 G A 6: 66,530,120 (GRCm39) R219* probably null Het
Vmn2r59 G A 7: 41,693,125 (GRCm39) P492S probably benign Het
Vmn2r59 G C 7: 41,693,127 (GRCm39) A491G Het
Wdr76 T C 2: 121,364,592 (GRCm39) Y299H probably damaging Het
Wnt5a C T 14: 28,240,309 (GRCm39) A153V probably benign Het
Zfp202 T C 9: 40,120,237 (GRCm39) V226A possibly damaging Het
Zfp219 C T 14: 52,244,598 (GRCm39) R527H probably damaging Het
Zfp408 A T 2: 91,475,528 (GRCm39) L542H probably damaging Het
Zfyve9 A T 4: 108,539,386 (GRCm39) C271* probably null Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154,454,156 (GRCm39) missense probably benign 0.44
IGL01141:Erich3 APN 3 154,419,653 (GRCm39) missense probably benign 0.08
IGL01812:Erich3 APN 3 154,419,608 (GRCm39) missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154,419,599 (GRCm39) missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154,433,114 (GRCm39) missense probably damaging 0.97
IGL03386:Erich3 APN 3 154,444,876 (GRCm39) missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154,469,150 (GRCm39) unclassified probably benign
R0942:Erich3 UTSW 3 154,444,788 (GRCm39) missense probably benign 0.00
R1558:Erich3 UTSW 3 154,419,705 (GRCm39) missense probably damaging 0.99
R1582:Erich3 UTSW 3 154,469,960 (GRCm39) unclassified probably benign
R1674:Erich3 UTSW 3 154,468,260 (GRCm39) unclassified probably benign
R1676:Erich3 UTSW 3 154,468,260 (GRCm39) unclassified probably benign
R1724:Erich3 UTSW 3 154,467,964 (GRCm39) missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154,401,402 (GRCm39) missense probably damaging 0.98
R1771:Erich3 UTSW 3 154,454,109 (GRCm39) missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154,470,288 (GRCm39) missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154,439,240 (GRCm39) missense probably damaging 0.98
R2507:Erich3 UTSW 3 154,404,296 (GRCm39) missense probably null 1.00
R3621:Erich3 UTSW 3 154,454,369 (GRCm39) missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154,469,958 (GRCm39) unclassified probably benign
R3756:Erich3 UTSW 3 154,470,215 (GRCm39) missense possibly damaging 0.66
R3756:Erich3 UTSW 3 154,469,958 (GRCm39) unclassified probably benign
R3832:Erich3 UTSW 3 154,467,998 (GRCm39) missense probably damaging 0.97
R4020:Erich3 UTSW 3 154,419,686 (GRCm39) missense probably damaging 0.97
R4601:Erich3 UTSW 3 154,470,375 (GRCm39) missense unknown
R4628:Erich3 UTSW 3 154,469,324 (GRCm39) missense probably damaging 1.00
R4841:Erich3 UTSW 3 154,410,480 (GRCm39) missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154,410,480 (GRCm39) missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154,470,441 (GRCm39) missense unknown
R4989:Erich3 UTSW 3 154,454,025 (GRCm39) missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154,469,217 (GRCm39) missense probably damaging 1.00
R5596:Erich3 UTSW 3 154,433,033 (GRCm39) missense probably damaging 0.99
R5695:Erich3 UTSW 3 154,439,210 (GRCm39) missense probably damaging 1.00
R5742:Erich3 UTSW 3 154,438,960 (GRCm39) missense probably damaging 1.00
R5859:Erich3 UTSW 3 154,468,134 (GRCm39) missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154,401,460 (GRCm39) missense probably damaging 1.00
R6172:Erich3 UTSW 3 154,469,978 (GRCm39) missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154,433,139 (GRCm39) missense probably damaging 1.00
R6438:Erich3 UTSW 3 154,401,390 (GRCm39) missense probably damaging 1.00
R6520:Erich3 UTSW 3 154,469,102 (GRCm39) missense probably damaging 0.98
R6679:Erich3 UTSW 3 154,468,066 (GRCm39) missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154,469,907 (GRCm39) unclassified probably benign
R6800:Erich3 UTSW 3 154,433,029 (GRCm39) critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154,433,074 (GRCm39) missense probably damaging 1.00
R6855:Erich3 UTSW 3 154,468,286 (GRCm39) nonsense probably null
R6989:Erich3 UTSW 3 154,469,314 (GRCm39) unclassified probably benign
R7400:Erich3 UTSW 3 154,468,214 (GRCm39) missense
R7421:Erich3 UTSW 3 154,439,198 (GRCm39) missense probably damaging 1.00
R7520:Erich3 UTSW 3 154,468,763 (GRCm39) missense unknown
R7553:Erich3 UTSW 3 154,439,137 (GRCm39) missense probably benign 0.01
R7751:Erich3 UTSW 3 154,469,426 (GRCm39) missense unknown
R7768:Erich3 UTSW 3 154,453,968 (GRCm39) missense probably benign 0.00
R7955:Erich3 UTSW 3 154,444,951 (GRCm39) nonsense probably null
R8001:Erich3 UTSW 3 154,419,553 (GRCm39) missense probably benign 0.21
R8101:Erich3 UTSW 3 154,439,150 (GRCm39) missense probably damaging 0.99
R8108:Erich3 UTSW 3 154,425,752 (GRCm39) missense possibly damaging 0.91
R8162:Erich3 UTSW 3 154,470,210 (GRCm39) missense unknown
R8310:Erich3 UTSW 3 154,410,586 (GRCm39) missense
R8360:Erich3 UTSW 3 154,469,991 (GRCm39) missense unknown
R8418:Erich3 UTSW 3 154,415,378 (GRCm39) missense
R8490:Erich3 UTSW 3 154,401,461 (GRCm39) missense
R8545:Erich3 UTSW 3 154,467,996 (GRCm39) unclassified probably benign
R8813:Erich3 UTSW 3 154,468,827 (GRCm39) missense unknown
R8944:Erich3 UTSW 3 154,462,692 (GRCm39) missense
R8987:Erich3 UTSW 3 154,415,340 (GRCm39) missense
R9036:Erich3 UTSW 3 154,468,886 (GRCm39) missense unknown
R9175:Erich3 UTSW 3 154,419,601 (GRCm39) missense probably benign 0.02
R9284:Erich3 UTSW 3 154,404,308 (GRCm39) missense
R9339:Erich3 UTSW 3 154,468,872 (GRCm39) missense unknown
R9626:Erich3 UTSW 3 154,444,730 (GRCm39) missense probably benign 0.10
Z1176:Erich3 UTSW 3 154,468,067 (GRCm39) missense
Z1176:Erich3 UTSW 3 154,404,338 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GCTTTGTACACATTTATCTAAGTGACC -3'
(R):5'- GGTACCATCTTCCTGCACCC -3'

Sequencing Primer
(F):5'- CATATCTCTCTTTTCCTCTCCCTC -3'
(R):5'- GCACCCCTACTCTCTCCTTCAG -3'
Posted On 2022-01-20