Incidental Mutation 'V7580:Atp6v1h'
ID 69393
Institutional Source Beutler Lab
Gene Symbol Atp6v1h
Ensembl Gene ENSMUSG00000033793
Gene Name ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms 0710001F19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # V7580 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 5070018-5162529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5124443 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 282 (T282A)
Ref Sequence ENSEMBL: ENSMUSP00000141636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044369] [ENSMUST00000192698] [ENSMUST00000192847]
AlphaFold Q8BVE3
Predicted Effect possibly damaging
Transcript: ENSMUST00000044369
AA Change: T282A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040756
Gene: ENSMUSG00000033793
AA Change: T282A

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 3e-106 PFAM
Pfam:V-ATPase_H_C 348 464 1.9e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192698
AA Change: T264A

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141797
Gene: ENSMUSG00000033793
AA Change: T264A

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 324 4.4e-104 PFAM
Pfam:V-ATPase_H_C 329 447 1.7e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192847
AA Change: T282A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141636
Gene: ENSMUSG00000033793
AA Change: T282A

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 1e-102 PFAM
Pfam:V-ATPase_H_C 332 423 2.7e-25 PFAM
Pfam:Arm_2 339 427 4.6e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194301
Meta Mutation Damage Score 0.3458 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular organelles. V-ATPase-dependent organelle acidification is necessary for multiple processes including protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. The encoded protein is the regulatory H subunit of the V1 domain of V-ATPase, which is required for catalysis of ATP but not the assembly of V-ATPase. Decreased expression of this gene may play a role in the development of type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for the allele exhbit bone loss with altered bone absorption and decreased bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,886,179 M950L probably benign Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Mylk G T 16: 34,995,204 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Atp6v1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Atp6v1h APN 1 5124471 critical splice donor site probably null
IGL00984:Atp6v1h APN 1 5095682 missense probably damaging 1.00
IGL01545:Atp6v1h APN 1 5089059 missense probably benign
IGL01788:Atp6v1h APN 1 5149983 missense possibly damaging 0.81
IGL02317:Atp6v1h APN 1 5084470 missense possibly damaging 0.95
IGL02679:Atp6v1h APN 1 5124302 missense probably damaging 1.00
IGL02944:Atp6v1h APN 1 5093355 splice site probably benign
IGL03119:Atp6v1h APN 1 5095669 missense probably benign 0.34
F5770:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
R0055:Atp6v1h UTSW 1 5084454 missense probably benign 0.01
R0055:Atp6v1h UTSW 1 5084454 missense probably benign 0.01
R0727:Atp6v1h UTSW 1 5084558 nonsense probably null
R1452:Atp6v1h UTSW 1 5098137 unclassified probably benign
R1465:Atp6v1h UTSW 1 5095688 missense probably damaging 1.00
R1465:Atp6v1h UTSW 1 5095688 missense probably damaging 1.00
R2273:Atp6v1h UTSW 1 5117476 missense probably damaging 1.00
R4512:Atp6v1h UTSW 1 5098135 critical splice donor site probably null
R4687:Atp6v1h UTSW 1 5133085 missense probably damaging 1.00
R5185:Atp6v1h UTSW 1 5095642 missense probably damaging 1.00
R5628:Atp6v1h UTSW 1 5135889 nonsense probably null
R5843:Atp6v1h UTSW 1 5162089 splice site probably null
R7037:Atp6v1h UTSW 1 5149992 missense possibly damaging 0.77
R7505:Atp6v1h UTSW 1 5124338 missense probably benign
R9098:Atp6v1h UTSW 1 5093415 missense probably damaging 1.00
R9291:Atp6v1h UTSW 1 5150061 missense probably null 0.40
R9348:Atp6v1h UTSW 1 5117476 missense probably damaging 1.00
V7581:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7582:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7583:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
Z1088:Atp6v1h UTSW 1 5098048 missense probably damaging 1.00
Z1176:Atp6v1h UTSW 1 5095628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGTTTCCATGCCTTCCAGAG -3'
(R):5'- TAGTCCTGTAGCAGGCACTGTAGC -3'

Sequencing Primer
(F):5'- TCCAGAGGGAGGTTTATAATTTAGC -3'
(R):5'- GGGTACTTTCTCCATCTGAATATAAC -3'
Posted On 2013-09-04