Incidental Mutation 'R9135:Nphp3'
ID 693944
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Name nephronophthisis 3 (adolescent)
Synonyms 3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9135 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 104002544-104043818 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 104032015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 808 (L808R)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194183] [ENSMUST00000194774]
AlphaFold Q7TNH6
Predicted Effect probably damaging
Transcript: ENSMUST00000035167
AA Change: L808R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: L808R

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193439
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194183
SMART Domains Protein: ENSMUSP00000142049
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
Pfam:TPR_10 1 37 3.4e-5 PFAM
Pfam:TPR_12 1 71 1.8e-14 PFAM
Pfam:TPR_10 38 79 6.5e-8 PFAM
Pfam:TPR_1 39 72 6.8e-4 PFAM
Pfam:TPR_10 81 115 9e-3 PFAM
Pfam:TPR_7 83 118 1.6e-2 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194774
AA Change: L688R
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: L688R

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,404 L513Q probably damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abi3bp A G 16: 56,596,810 D419G probably benign Het
Acoxl A T 2: 127,854,771 probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Adgra2 T C 8: 27,120,951 L976P probably damaging Het
Adora2b A G 11: 62,265,060 probably null Het
Ak1 A T 2: 32,631,170 Q117L probably damaging Het
Akr1c14 T A 13: 4,078,029 D143E probably damaging Het
Ap4e1 A T 2: 127,019,322 H127L probably damaging Het
Asxl3 T A 18: 22,516,613 I553N probably damaging Het
Asxl3 T A 18: 22,524,424 N1830K possibly damaging Het
Atp11a G A 8: 12,813,144 A108T probably damaging Het
Bag6 A G 17: 35,143,461 T582A unknown Het
Bbs9 T C 9: 22,578,709 S259P probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Blvrb T C 7: 27,465,785 S177P probably damaging Het
C1s2 T A 6: 124,625,683 D523V probably benign Het
Cacna2d1 C T 5: 16,353,852 T736I probably damaging Het
Card9 T C 2: 26,352,385 N513S probably benign Het
Casp2 A G 6: 42,268,948 T180A probably benign Het
Cenpf A T 1: 189,672,549 L361Q probably damaging Het
Cnbd2 T C 2: 156,375,568 I659T probably damaging Het
Cped1 A T 6: 21,987,013 D68V probably damaging Het
Cxcr1 T C 1: 74,191,940 I308V probably benign Het
Dad1 A G 14: 54,253,706 L46P probably damaging Het
Defb23 G A 2: 152,459,502 A50V probably benign Het
Dhx33 C T 11: 70,987,166 A684T probably damaging Het
Epb41l4a T A 18: 33,832,676 N366I probably benign Het
Erich3 A G 3: 154,762,275 E788G Het
Fam241b T C 10: 62,109,113 N35S probably benign Het
Fbxo24 T A 5: 137,624,264 Q80L probably benign Het
Foxk1 T G 5: 142,448,742 F254V probably benign Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm12886 T C 4: 121,417,546 I46V probably benign Het
Gm20834 G T Y: 10,323,354 H27Q probably damaging Het
Gm2888 A G 14: 3,032,106 N138S probably damaging Het
Gm5773 T C 3: 93,773,872 C284R possibly damaging Het
Gprin3 A T 6: 59,353,288 M678K probably benign Het
Grm7 T C 6: 111,495,768 V856A probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Immt C T 6: 71,874,419 T588I probably damaging Het
Ints1 G C 5: 139,751,946 N2145K possibly damaging Het
Jade2 T C 11: 51,825,124 D418G probably benign Het
Kdf1 T C 4: 133,528,829 Y286H probably damaging Het
Kif18a A G 2: 109,341,161 Y861C possibly damaging Het
Lama2 T A 10: 27,422,519 I194F probably damaging Het
Lhx8 A G 3: 154,328,426 S33P probably benign Het
Lmo7 T C 14: 101,880,861 I174T probably damaging Het
Lrfn2 A T 17: 49,069,948 D19V possibly damaging Het
Lrrk1 A T 7: 66,278,609 I1257N probably damaging Het
Malrd1 T A 2: 15,797,705 H1076Q unknown Het
Map3k14 A C 11: 103,237,538 M419R probably damaging Het
Mcm10 G A 2: 5,006,561 R200C probably benign Het
Mertk A G 2: 128,762,115 N390D probably benign Het
Mitf T A 6: 98,013,719 I361N probably damaging Het
Mrgprb1 T A 7: 48,447,298 I289F possibly damaging Het
Muc5ac A T 7: 141,798,481 D659V probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Olfr1434 T A 19: 12,283,444 L132Q probably damaging Het
Olfr1467 T A 19: 13,365,391 S254R possibly damaging Het
Olfr20 T C 11: 73,354,490 S246P probably damaging Het
Olfr296-ps1 G A 7: 86,561,948 C72Y unknown Het
Pagr1a T C 7: 127,016,782 E47G probably benign Het
Papss2 G T 19: 32,641,364 R274L probably damaging Het
Pcdhga10 C A 18: 37,747,907 F240L probably damaging Het
Pcsk5 T G 19: 17,586,108 E555A Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pgrmc2 T A 3: 41,068,664 D206V probably damaging Het
Pkd1 T C 17: 24,572,002 V1057A Het
Plekha5 T C 6: 140,534,513 I113T probably damaging Het
Prss32 C T 17: 23,859,225 T295I possibly damaging Het
Ptprk G T 10: 28,580,417 V1072F probably damaging Het
Rasd2 T A 8: 75,218,546 M1K probably null Het
Rhag T A 17: 40,828,411 M79K probably damaging Het
Rnf19a C A 15: 36,253,164 probably null Het
Rnf213 G T 11: 119,408,747 G101C Het
Sap130 T A 18: 31,647,063 D45E probably benign Het
Scel T A 14: 103,602,190 F510I probably benign Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Shoc2 T A 19: 53,987,879 S67T probably benign Het
Slc22a3 T C 17: 12,426,732 I441V possibly damaging Het
Slfn5 A G 11: 82,960,677 D600G probably benign Het
Smim7 G A 8: 72,570,913 T10M probably damaging Het
Sntb2 A T 8: 106,936,199 Q133L possibly damaging Het
Steap3 A C 1: 120,234,318 M408R probably benign Het
Supt4a T C 11: 87,742,798 I60T probably benign Het
Swt1 A C 1: 151,368,488 C899G possibly damaging Het
Taok3 A G 5: 117,206,679 E157G probably damaging Het
Taok3 T C 5: 117,241,103 V401A probably benign Het
Taok3 C T 5: 117,241,180 L427F possibly damaging Het
Tcf25 A G 8: 123,381,443 E79G probably benign Het
Tigit G A 16: 43,659,513 L140F possibly damaging Het
Tmem143 G T 7: 45,897,378 probably benign Het
Tmem151b C T 17: 45,545,429 V362M possibly damaging Het
Tmem230 A G 2: 132,244,069 F58L probably benign Het
Trim25 T C 11: 89,009,162 M245T probably benign Het
Trim36 A C 18: 46,169,343 V546G probably benign Het
Triml1 T C 8: 43,130,587 N326D probably damaging Het
Trp53bp2 T C 1: 182,458,763 V1056A probably damaging Het
Trpa1 C A 1: 14,882,211 M865I probably damaging Het
Ttbk1 A T 17: 46,479,206 Y104* probably null Het
Tubg1 T A 11: 101,123,431 H139Q probably damaging Het
Ufsp2 A G 8: 45,994,013 probably null Het
Uhrf1bp1 T A 17: 27,885,928 L532* probably null Het
Usp47 A T 7: 112,053,224 N36I probably benign Het
Vmn1r32 G A 6: 66,553,136 R219* probably null Het
Vmn2r59 G A 7: 42,043,701 P492S probably benign Het
Vmn2r59 G C 7: 42,043,703 A491G Het
Wdr63 T C 3: 146,066,834 T486A probably benign Het
Wdr76 T C 2: 121,534,111 Y299H probably damaging Het
Wnt5a C T 14: 28,518,352 A153V probably benign Het
Zfp202 T C 9: 40,208,941 V226A possibly damaging Het
Zfp219 C T 14: 52,007,141 R527H probably damaging Het
Zfp408 A T 2: 91,645,183 L542H probably damaging Het
Zfyve9 A T 4: 108,682,189 C271* probably null Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 splice site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
R8145:Nphp3 UTSW 9 104035851 missense probably benign 0.16
R8211:Nphp3 UTSW 9 104031897 missense possibly damaging 0.80
R8882:Nphp3 UTSW 9 104005594 missense possibly damaging 0.77
R9020:Nphp3 UTSW 9 104031951 missense probably benign 0.00
R9132:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9159:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9204:Nphp3 UTSW 9 104042106 missense probably benign
R9226:Nphp3 UTSW 9 104008129 missense probably benign 0.00
R9229:Nphp3 UTSW 9 104036177 missense probably damaging 1.00
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAATTCTTGGCCATGGTTTC -3'
(R):5'- GTTGGACAGGTTTCACATGC -3'

Sequencing Primer
(F):5'- CCATGGTTTCTGGGGTAGCC -3'
(R):5'- GGACAGGTTTCACATGCAATTTAAAG -3'
Posted On 2022-01-20