Mutagenetix > Incidental Mutation

Incidental Mutation 'V7580:Lrp4'

69396

Institutional Source

Beutler Lab

Gene Symbol

Lrp4

Ensembl Gene

ENSMUSG00000027253

Gene Name

low density lipoprotein receptor-related protein 4

Synonyms

mdig, Megf7

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.663) question?

Stock #

V7580 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91457511-91513779 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 91488518 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 900 (S900L)

Ref Sequence

ENSEMBL: ENSMUSP00000028689 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028689]

AlphaFold

Q8VI56

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028689
AA Change: S900L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253
AA Change: S900L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LDLa	26	68	5.77e-10	SMART
LDLa	70	107	4.05e-14	SMART
LDLa	109	145	1.9e-10	SMART
LDLa	147	184	1.51e-13	SMART
LDLa	190	227	6.83e-12	SMART
LDLa	230	267	2.45e-13	SMART
LDLa	269	306	6.32e-16	SMART
LDLa	311	351	3.24e-13	SMART
EGF	357	394	1.4e0	SMART
EGF_CA	395	434	1.05e-8	SMART
LY	460	502	7.01e-10	SMART
LY	503	545	4.41e-16	SMART
LY	546	589	1.04e-12	SMART
LY	590	632	5.07e-16	SMART
LY	633	674	3.12e-7	SMART
EGF	701	737	9.27e-1	SMART
LY	765	807	7.29e-8	SMART
LY	808	850	1.92e-16	SMART
LY	851	894	3.05e-10	SMART
LY	895	937	6.69e-16	SMART
LY	938	979	8.71e-6	SMART
EGF	1005	1044	1.64e-1	SMART
LY	1073	1115	2.58e-8	SMART
LY	1116	1158	1.57e-12	SMART
LY	1159	1202	7.4e-9	SMART
LY	1203	1245	9.39e-11	SMART
LY	1246	1285	6.11e-1	SMART
EGF	1312	1349	1.53e-1	SMART
LY	1377	1419	4.42e-7	SMART
LY	1420	1462	1.04e-12	SMART
LY	1463	1506	2.11e-13	SMART
LY	1507	1549	4.66e-15	SMART
LY	1550	1590	2.02e-1	SMART
EGF_like	1616	1649	5.79e1	SMART
low complexity region	1674	1690	N/A	INTRINSIC
transmembrane domain	1724	1746	N/A	INTRINSIC
low complexity region	1857	1870	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Med20	G	A	17: 47,618,832	V65M	probably damaging	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Lrp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Lrp4	APN	2	91495026	missense	probably benign
IGL00509:Lrp4	APN	2	91486174	splice site	probably benign
IGL01145:Lrp4	APN	2	91487051	missense	probably damaging	1.00
IGL01287:Lrp4	APN	2	91473948	missense	probably damaging	1.00
IGL01531:Lrp4	APN	2	91511553	missense	probably damaging	1.00
IGL01534:Lrp4	APN	2	91473641	missense	probably damaging	1.00
IGL01544:Lrp4	APN	2	91477551	missense	probably damaging	1.00
IGL01761:Lrp4	APN	2	91481981	critical splice donor site	probably null
IGL01885:Lrp4	APN	2	91501107	missense	probably benign	0.05
IGL01909:Lrp4	APN	2	91494184	missense	possibly damaging	0.50
IGL02111:Lrp4	APN	2	91506059	missense	probably damaging	1.00
IGL02385:Lrp4	APN	2	91474720	missense	possibly damaging	0.89
IGL02403:Lrp4	APN	2	91508582	missense	probably benign	0.05
IGL02431:Lrp4	APN	2	91476637	missense	possibly damaging	0.95
IGL02452:Lrp4	APN	2	91474002	missense	probably damaging	1.00
IGL02798:Lrp4	APN	2	91476710	missense	probably benign	0.02
IGL02828:Lrp4	APN	2	91475294	missense	probably benign
IGL02832:Lrp4	APN	2	91511580	missense	probably damaging	1.00
IGL02893:Lrp4	APN	2	91474816	missense	possibly damaging	0.76
artiodactyl	UTSW	2	91494994	missense	probably damaging	0.99
bubalus	UTSW	2	91494955	missense	possibly damaging	0.71
riverhorse	UTSW	2	91480321	missense	probably damaging	1.00
wallow	UTSW	2	91477698	missense	probably benign	0.09
F5770:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
R0037:Lrp4	UTSW	2	91471203	missense	probably benign	0.22
R0037:Lrp4	UTSW	2	91471203	missense	probably benign	0.22
R0137:Lrp4	UTSW	2	91494982	missense	probably damaging	1.00
R0265:Lrp4	UTSW	2	91490670	missense	probably damaging	1.00
R0368:Lrp4	UTSW	2	91477734	missense	probably damaging	0.99
R0531:Lrp4	UTSW	2	91475178	splice site	probably benign
R0827:Lrp4	UTSW	2	91495041	missense	probably damaging	1.00
R1029:Lrp4	UTSW	2	91487027	splice site	probably benign
R1183:Lrp4	UTSW	2	91477519	critical splice acceptor site	probably null
R1587:Lrp4	UTSW	2	91476305	missense	probably benign	0.26
R1693:Lrp4	UTSW	2	91492353	missense	probably damaging	1.00
R1747:Lrp4	UTSW	2	91492621	missense	probably damaging	0.98
R1863:Lrp4	UTSW	2	91498363	missense	probably benign	0.15
R1908:Lrp4	UTSW	2	91498408	missense	possibly damaging	0.93
R1909:Lrp4	UTSW	2	91498408	missense	possibly damaging	0.93
R1932:Lrp4	UTSW	2	91497355	nonsense	probably null
R1934:Lrp4	UTSW	2	91480432	missense	probably damaging	1.00
R2358:Lrp4	UTSW	2	91501954	missense	probably benign	0.01
R2433:Lrp4	UTSW	2	91506015	missense	probably benign	0.00
R2698:Lrp4	UTSW	2	91475212	missense	probably damaging	0.99
R2919:Lrp4	UTSW	2	91490730	missense	probably benign	0.01
R3105:Lrp4	UTSW	2	91501049	missense	probably benign
R3709:Lrp4	UTSW	2	91490466	missense	possibly damaging	0.60
R3711:Lrp4	UTSW	2	91501954	missense	probably benign	0.01
R3735:Lrp4	UTSW	2	91498371	missense	probably damaging	1.00
R3808:Lrp4	UTSW	2	91476702	missense	probably damaging	0.99
R3894:Lrp4	UTSW	2	91473949	missense	probably damaging	1.00
R3895:Lrp4	UTSW	2	91473949	missense	probably damaging	1.00
R4397:Lrp4	UTSW	2	91511670	missense	probably benign	0.20
R4741:Lrp4	UTSW	2	91511567	missense	probably damaging	1.00
R4948:Lrp4	UTSW	2	91485886	missense	probably benign
R5050:Lrp4	UTSW	2	91492422	missense	probably benign	0.22
R5096:Lrp4	UTSW	2	91485792	missense	possibly damaging	0.65
R5110:Lrp4	UTSW	2	91497072	missense	possibly damaging	0.48
R5141:Lrp4	UTSW	2	91478678	splice site	probably benign
R5439:Lrp4	UTSW	2	91497073	missense	probably benign	0.14
R5725:Lrp4	UTSW	2	91494895	missense	probably damaging	1.00
R5795:Lrp4	UTSW	2	91474471	missense	probably benign	0.01
R5820:Lrp4	UTSW	2	91492615	missense	probably damaging	0.99
R5883:Lrp4	UTSW	2	91488433	missense	probably benign	0.01
R5919:Lrp4	UTSW	2	91473207	missense	probably damaging	1.00
R5925:Lrp4	UTSW	2	91511684	missense	probably benign	0.01
R6080:Lrp4	UTSW	2	91502000	missense	probably benign
R6189:Lrp4	UTSW	2	91475234	missense	possibly damaging	0.63
R6192:Lrp4	UTSW	2	91508488	missense	probably benign	0.00
R6319:Lrp4	UTSW	2	91480321	missense	probably damaging	1.00
R6378:Lrp4	UTSW	2	91493829	missense	probably benign	0.18
R6479:Lrp4	UTSW	2	91487084	missense	probably damaging	0.96
R6500:Lrp4	UTSW	2	91492420	missense	possibly damaging	0.90
R6643:Lrp4	UTSW	2	91501995	missense	probably benign
R6657:Lrp4	UTSW	2	91492053	missense	probably benign	0.00
R6696:Lrp4	UTSW	2	91497345	missense	probably benign	0.03
R6714:Lrp4	UTSW	2	91476365	missense	possibly damaging	0.90
R6734:Lrp4	UTSW	2	91485897	missense	possibly damaging	0.79
R6770:Lrp4	UTSW	2	91497303	missense	probably benign	0.33
R6774:Lrp4	UTSW	2	91511504	missense	probably benign	0.01
R6957:Lrp4	UTSW	2	91487042	missense	probably damaging	0.99
R6978:Lrp4	UTSW	2	91491998	missense	probably damaging	1.00
R7065:Lrp4	UTSW	2	91511580	missense	probably damaging	1.00
R7142:Lrp4	UTSW	2	91494994	missense	probably damaging	0.99
R7219:Lrp4	UTSW	2	91492023	missense	probably damaging	1.00
R7237:Lrp4	UTSW	2	91473183	missense	probably benign	0.04
R7387:Lrp4	UTSW	2	91476614	missense	probably benign
R7585:Lrp4	UTSW	2	91492588	missense	probably damaging	1.00
R7835:Lrp4	UTSW	2	91495042	missense	possibly damaging	0.82
R7872:Lrp4	UTSW	2	91490716	missense	possibly damaging	0.54
R7968:Lrp4	UTSW	2	91494079	missense	possibly damaging	0.74
R8222:Lrp4	UTSW	2	91474741	missense	probably damaging	1.00
R8338:Lrp4	UTSW	2	91492368	missense	probably benign	0.15
R8342:Lrp4	UTSW	2	91488445	missense	probably damaging	1.00
R8435:Lrp4	UTSW	2	91477653	missense	probably damaging	1.00
R8720:Lrp4	UTSW	2	91494114	missense	probably damaging	1.00
R8774:Lrp4	UTSW	2	91477698	missense	probably benign	0.09
R8774-TAIL:Lrp4	UTSW	2	91477698	missense	probably benign	0.09
R8792:Lrp4	UTSW	2	91494955	missense	possibly damaging	0.71
R8913:Lrp4	UTSW	2	91501440	missense	probably benign	0.11
R9017:Lrp4	UTSW	2	91494052	missense	possibly damaging	0.51
R9062:Lrp4	UTSW	2	91473580	missense	possibly damaging	0.46
R9118:Lrp4	UTSW	2	91478582	missense	possibly damaging	0.91
R9640:Lrp4	UTSW	2	91485951	missense	probably benign	0.02
R9649:Lrp4	UTSW	2	91508569	missense	possibly damaging	0.46
R9708:Lrp4	UTSW	2	91511731	missense	probably benign	0.02
R9748:Lrp4	UTSW	2	91485771	missense	probably damaging	0.99
R9776:Lrp4	UTSW	2	91485834	missense	probably damaging	1.00
V7581:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
V7582:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
V7583:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
X0021:Lrp4	UTSW	2	91501062	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AAAGCCTTTGAGGACCCTGCAC -3'
(R):5'- TTGAATCGTCAACCAGCAGCCC -3'

Sequencing Primer
(F):5'- GGACCCTGCACCCTCATC -3'
(R):5'- TGGAGCTACAGTCTTAGACAAAC -3'

Posted On

2013-09-04