Incidental Mutation 'R9135:Scel'
ID 693966
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9135 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103602190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 510 (F510I)
Ref Sequence ENSEMBL: ENSMUSP00000093233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect probably benign
Transcript: ENSMUST00000095576
AA Change: F510I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: F510I

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
AA Change: F490I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,404 L513Q probably damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abi3bp A G 16: 56,596,810 D419G probably benign Het
Acoxl A T 2: 127,854,771 probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Adgra2 T C 8: 27,120,951 L976P probably damaging Het
Adora2b A G 11: 62,265,060 probably null Het
Ak1 A T 2: 32,631,170 Q117L probably damaging Het
Akr1c14 T A 13: 4,078,029 D143E probably damaging Het
Ap4e1 A T 2: 127,019,322 H127L probably damaging Het
Asxl3 T A 18: 22,516,613 I553N probably damaging Het
Asxl3 T A 18: 22,524,424 N1830K possibly damaging Het
Atp11a G A 8: 12,813,144 A108T probably damaging Het
Bag6 A G 17: 35,143,461 T582A unknown Het
Bbs9 T C 9: 22,578,709 S259P probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Blvrb T C 7: 27,465,785 S177P probably damaging Het
C1s2 T A 6: 124,625,683 D523V probably benign Het
Cacna2d1 C T 5: 16,353,852 T736I probably damaging Het
Card9 T C 2: 26,352,385 N513S probably benign Het
Casp2 A G 6: 42,268,948 T180A probably benign Het
Cenpf A T 1: 189,672,549 L361Q probably damaging Het
Cnbd2 T C 2: 156,375,568 I659T probably damaging Het
Cped1 A T 6: 21,987,013 D68V probably damaging Het
Cxcr1 T C 1: 74,191,940 I308V probably benign Het
Dad1 A G 14: 54,253,706 L46P probably damaging Het
Defb23 G A 2: 152,459,502 A50V probably benign Het
Dhx33 C T 11: 70,987,166 A684T probably damaging Het
Epb41l4a T A 18: 33,832,676 N366I probably benign Het
Erich3 A G 3: 154,762,275 E788G Het
Fam241b T C 10: 62,109,113 N35S probably benign Het
Fbxo24 T A 5: 137,624,264 Q80L probably benign Het
Foxk1 T G 5: 142,448,742 F254V probably benign Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm12886 T C 4: 121,417,546 I46V probably benign Het
Gm20834 G T Y: 10,323,354 H27Q probably damaging Het
Gm2888 A G 14: 3,032,106 N138S probably damaging Het
Gm5773 T C 3: 93,773,872 C284R possibly damaging Het
Gprin3 A T 6: 59,353,288 M678K probably benign Het
Grm7 T C 6: 111,495,768 V856A probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Immt C T 6: 71,874,419 T588I probably damaging Het
Ints1 G C 5: 139,751,946 N2145K possibly damaging Het
Jade2 T C 11: 51,825,124 D418G probably benign Het
Kdf1 T C 4: 133,528,829 Y286H probably damaging Het
Kif18a A G 2: 109,341,161 Y861C possibly damaging Het
Lama2 T A 10: 27,422,519 I194F probably damaging Het
Lhx8 A G 3: 154,328,426 S33P probably benign Het
Lmo7 T C 14: 101,880,861 I174T probably damaging Het
Lrfn2 A T 17: 49,069,948 D19V possibly damaging Het
Lrrk1 A T 7: 66,278,609 I1257N probably damaging Het
Malrd1 T A 2: 15,797,705 H1076Q unknown Het
Map3k14 A C 11: 103,237,538 M419R probably damaging Het
Mcm10 G A 2: 5,006,561 R200C probably benign Het
Mertk A G 2: 128,762,115 N390D probably benign Het
Mitf T A 6: 98,013,719 I361N probably damaging Het
Mrgprb1 T A 7: 48,447,298 I289F possibly damaging Het
Muc5ac A T 7: 141,798,481 D659V probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nphp3 T G 9: 104,032,015 L808R probably damaging Het
Olfr1434 T A 19: 12,283,444 L132Q probably damaging Het
Olfr1467 T A 19: 13,365,391 S254R possibly damaging Het
Olfr20 T C 11: 73,354,490 S246P probably damaging Het
Olfr296-ps1 G A 7: 86,561,948 C72Y unknown Het
Pagr1a T C 7: 127,016,782 E47G probably benign Het
Papss2 G T 19: 32,641,364 R274L probably damaging Het
Pcdhga10 C A 18: 37,747,907 F240L probably damaging Het
Pcsk5 T G 19: 17,586,108 E555A Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pgrmc2 T A 3: 41,068,664 D206V probably damaging Het
Pkd1 T C 17: 24,572,002 V1057A Het
Plekha5 T C 6: 140,534,513 I113T probably damaging Het
Prss32 C T 17: 23,859,225 T295I possibly damaging Het
Ptprk G T 10: 28,580,417 V1072F probably damaging Het
Rasd2 T A 8: 75,218,546 M1K probably null Het
Rhag T A 17: 40,828,411 M79K probably damaging Het
Rnf19a C A 15: 36,253,164 probably null Het
Rnf213 G T 11: 119,408,747 G101C Het
Sap130 T A 18: 31,647,063 D45E probably benign Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Shoc2 T A 19: 53,987,879 S67T probably benign Het
Slc22a3 T C 17: 12,426,732 I441V possibly damaging Het
Slfn5 A G 11: 82,960,677 D600G probably benign Het
Smim7 G A 8: 72,570,913 T10M probably damaging Het
Sntb2 A T 8: 106,936,199 Q133L possibly damaging Het
Steap3 A C 1: 120,234,318 M408R probably benign Het
Supt4a T C 11: 87,742,798 I60T probably benign Het
Swt1 A C 1: 151,368,488 C899G possibly damaging Het
Taok3 A G 5: 117,206,679 E157G probably damaging Het
Taok3 T C 5: 117,241,103 V401A probably benign Het
Taok3 C T 5: 117,241,180 L427F possibly damaging Het
Tcf25 A G 8: 123,381,443 E79G probably benign Het
Tigit G A 16: 43,659,513 L140F possibly damaging Het
Tmem143 G T 7: 45,897,378 probably benign Het
Tmem151b C T 17: 45,545,429 V362M possibly damaging Het
Tmem230 A G 2: 132,244,069 F58L probably benign Het
Trim25 T C 11: 89,009,162 M245T probably benign Het
Trim36 A C 18: 46,169,343 V546G probably benign Het
Triml1 T C 8: 43,130,587 N326D probably damaging Het
Trp53bp2 T C 1: 182,458,763 V1056A probably damaging Het
Trpa1 C A 1: 14,882,211 M865I probably damaging Het
Ttbk1 A T 17: 46,479,206 Y104* probably null Het
Tubg1 T A 11: 101,123,431 H139Q probably damaging Het
Ufsp2 A G 8: 45,994,013 probably null Het
Uhrf1bp1 T A 17: 27,885,928 L532* probably null Het
Usp47 A T 7: 112,053,224 N36I probably benign Het
Vmn1r32 G A 6: 66,553,136 R219* probably null Het
Vmn2r59 G A 7: 42,043,701 P492S probably benign Het
Vmn2r59 G C 7: 42,043,703 A491G Het
Wdr63 T C 3: 146,066,834 T486A probably benign Het
Wdr76 T C 2: 121,534,111 Y299H probably damaging Het
Wnt5a C T 14: 28,518,352 A153V probably benign Het
Zfp202 T C 9: 40,208,941 V226A possibly damaging Het
Zfp219 C T 14: 52,007,141 R527H probably damaging Het
Zfp408 A T 2: 91,645,183 L542H probably damaging Het
Zfyve9 A T 4: 108,682,189 C271* probably null Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9014:Scel UTSW 14 103585139 missense probably benign
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CGTTCTGTAAGTACCTGTGCAG -3'
(R):5'- AGCAACAGCTACGTTCTACATTC -3'

Sequencing Primer
(F):5'- GTTCTGTAAGTACCTGTGCAGAAACC -3'
(R):5'- TATGTCCCAGCAATCACTGAG -3'
Posted On 2022-01-20