Mutagenetix > Incidental Mutation

Incidental Mutation 'V7580:Cfi'

69403

Institutional Source

Beutler Lab

Gene Symbol

Cfi

Ensembl Gene

ENSMUSG00000058952

Gene Name

complement component factor i

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

V7580 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129835884-129875332 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 129854992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 175 (I175K)

Ref Sequence

ENSEMBL: ENSMUSP00000077074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077918] [ENSMUST00000200206]

AlphaFold

Q61129

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077918
AA Change: I175K

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: I175K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
FIMAC	45	111	4.63e-38	SMART
KAZAL	63	109	6.91e-3	SMART
SR	117	220	2.95e-22	SMART
LDLa	225	262	1.07e-4	SMART
LDLa	263	300	7.16e-6	SMART
low complexity region	317	326	N/A	INTRINSIC
Tryp_SPc	360	589	3.33e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200206

SMART Domains

Protein: ENSMUSP00000142975
Gene: ENSMUSG00000058952

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
FIMAC	45	111	2.2e-40	SMART
KAZAL	63	109	4.4e-5	SMART
Blast:SR	117	145	3e-11	BLAST

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Med20	G	A	17: 47,618,832	V65M	probably damaging	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Cfi

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Cfi	APN	3	129873095	missense	probably damaging	0.97
IGL00659:Cfi	APN	3	129836813	missense	unknown
IGL01310:Cfi	APN	3	129858431	missense	probably damaging	1.00
IGL01387:Cfi	APN	3	129874913	unclassified	probably benign
IGL01897:Cfi	APN	3	129858385	missense	probably damaging	1.00
IGL02418:Cfi	APN	3	129848812	missense	probably benign	0.20
F5770:Cfi	UTSW	3	129854992	missense	possibly damaging	0.62
R0085:Cfi	UTSW	3	129874986	missense	probably benign	0.00
R0102:Cfi	UTSW	3	129848767	missense	probably damaging	0.97
R0102:Cfi	UTSW	3	129848767	missense	probably damaging	0.97
R0835:Cfi	UTSW	3	129868542	missense	probably damaging	1.00
R1191:Cfi	UTSW	3	129868527	missense	probably benign	0.01
R1221:Cfi	UTSW	3	129872969	missense	probably damaging	0.99
R1576:Cfi	UTSW	3	129873050	missense	probably damaging	0.98
R1809:Cfi	UTSW	3	129873119	critical splice donor site	probably null
R1940:Cfi	UTSW	3	129858828	splice site	probably benign
R1983:Cfi	UTSW	3	129868545	missense	probably damaging	1.00
R2069:Cfi	UTSW	3	129858804	splice site	probably null
R3012:Cfi	UTSW	3	129874930	missense	probably damaging	1.00
R4334:Cfi	UTSW	3	129850829	missense	possibly damaging	0.80
R4596:Cfi	UTSW	3	129868500	missense	probably damaging	0.98
R4888:Cfi	UTSW	3	129873077	missense	probably damaging	1.00
R5121:Cfi	UTSW	3	129873077	missense	probably damaging	1.00
R5322:Cfi	UTSW	3	129873040	missense	probably damaging	1.00
R5673:Cfi	UTSW	3	129855009	missense	probably benign	0.02
R6084:Cfi	UTSW	3	129858370	missense	probably benign	0.00
R6364:Cfi	UTSW	3	129872846	missense	probably benign	0.36
R6770:Cfi	UTSW	3	129858730	missense	probably benign	0.21
R7000:Cfi	UTSW	3	129872873	missense	probably damaging	1.00
R7108:Cfi	UTSW	3	129875016	missense	probably damaging	1.00
R7194:Cfi	UTSW	3	129855059	missense	probably damaging	1.00
R7342:Cfi	UTSW	3	129875132	missense	probably damaging	1.00
R7470:Cfi	UTSW	3	129855087	missense	probably benign	0.01
R7538:Cfi	UTSW	3	129858815	missense	probably benign	0.08
R7908:Cfi	UTSW	3	129848584	missense	probably benign	0.01
R7954:Cfi	UTSW	3	129868585	critical splice donor site	probably null
R8017:Cfi	UTSW	3	129855099	missense	probably benign	0.00
R8135:Cfi	UTSW	3	129855000	missense	probably benign	0.00
R8155:Cfi	UTSW	3	129855090	missense	probably benign	0.00
R8217:Cfi	UTSW	3	129855001	missense	possibly damaging	0.61
R8530:Cfi	UTSW	3	129850733	missense	possibly damaging	0.79
R8767:Cfi	UTSW	3	129850848	critical splice donor site	probably null
R9578:Cfi	UTSW	3	129865375	missense	probably benign
R9590:Cfi	UTSW	3	129848812	missense	probably benign	0.02
R9774:Cfi	UTSW	3	129874996	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCGGTGTTTTCAACCCTACCTG -3'
(R):5'- GCATCCTGCTTGTAACACACTACCC -3'

Sequencing Primer
(F):5'- TTTCCAAAACCCCAGAGGTATTAAGG -3'
(R):5'- GTAACACACTACCCCCGCC -3'

Posted On

2013-09-04