Incidental Mutation 'R9136:Uqcrc1'
ID 694031
Institutional Source Beutler Lab
Gene Symbol Uqcrc1
Ensembl Gene ENSMUSG00000025651
Gene Name ubiquinol-cytochrome c reductase core protein 1
Synonyms 1110032G10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock # R9136 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108936633-108949623 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108947905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 393 (N393D)
Ref Sequence ENSEMBL: ENSMUSP00000026743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026743] [ENSMUST00000194047] [ENSMUST00000194469] [ENSMUST00000195738]
AlphaFold Q9CZ13
Predicted Effect possibly damaging
Transcript: ENSMUST00000026743
AA Change: N393D

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026743
Gene: ENSMUSG00000025651
AA Change: N393D

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
Pfam:Peptidase_M16 58 205 2.1e-54 PFAM
Pfam:Peptidase_M16_C 210 395 3.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192305
Predicted Effect probably benign
Transcript: ENSMUST00000194047
SMART Domains Protein: ENSMUSP00000141435
Gene: ENSMUSG00000025651

DomainStartEndE-ValueType
Pfam:Peptidase_M16 41 188 7.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194469
AA Change: N92D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141743
Gene: ENSMUSG00000025651
AA Change: N92D

DomainStartEndE-ValueType
Pfam:Peptidase_M16_C 1 94 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195738
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik C T 12: 55,303,942 P12L probably benign Het
Abca3 A G 17: 24,377,833 Q420R probably benign Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Acsl5 A T 19: 55,277,968 K109N probably benign Het
Agpat3 T C 10: 78,285,059 N95S probably damaging Het
Akna C T 4: 63,392,155 D451N probably damaging Het
Ankrd17 A T 5: 90,244,419 D1797E probably damaging Het
Ano2 A G 6: 125,982,999 N691S probably damaging Het
Ccdc63 G A 5: 122,121,083 R251W probably damaging Het
Cd70 T C 17: 57,146,152 T171A possibly damaging Het
Cenpf A T 1: 189,671,155 S382T probably benign Het
Ddx19b G T 8: 111,008,274 D487E probably benign Het
Dlgap4 G A 2: 156,746,155 E640K possibly damaging Het
Dtnbp1 A T 13: 44,931,070 F198Y possibly damaging Het
Epha10 T C 4: 124,902,634 Y379H Het
Eral1 A G 11: 78,074,134 I411T Het
Exd1 C T 2: 119,528,904 G193E probably damaging Het
Fat3 C A 9: 15,922,442 A105S Het
Fbp2 C T 13: 62,855,026 V71M possibly damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11273 A C 13: 21,501,417 M1R probably null Het
Gm13762 T A 2: 88,973,769 M41L probably benign Het
Gm15448 A T 7: 3,823,286 I236N Het
Grm5 G A 7: 88,040,046 V542I possibly damaging Het
Hdc C T 2: 126,597,866 probably null Het
Hspe1 G T 1: 55,089,155 K36N probably damaging Het
Hypk T A 2: 121,457,155 L17* probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Immt C T 6: 71,874,419 T588I probably damaging Het
Kat2b T A 17: 53,629,336 S179T probably benign Het
Krtap19-5 C T 16: 88,896,358 G22D unknown Het
Lipk A G 19: 34,022,430 D153G probably damaging Het
Lnpep A G 17: 17,529,828 V1000A probably benign Het
Map3k7cl T C 16: 87,594,339 L117P probably damaging Het
Meikin A G 11: 54,394,638 E167G possibly damaging Het
Miox A G 15: 89,336,537 Y215C probably damaging Het
Mthfd1 T G 12: 76,303,875 M677R probably damaging Het
Ncoa7 G A 10: 30,691,632 S350L probably benign Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nrg3 A T 14: 38,397,305 N403K possibly damaging Het
Nup210 T C 6: 91,043,848 T955A possibly damaging Het
Odf2l C A 3: 145,145,937 T82K Het
Olfr1118 A G 2: 87,308,875 I49V possibly damaging Het
Olfr1132 A G 2: 87,634,997 V250A probably benign Het
Olfr24 T C 9: 18,754,879 Y252C probably damaging Het
Pcm1 C T 8: 41,279,788 S694L probably benign Het
Pex11b T C 3: 96,643,943 L248P probably damaging Het
Ppp3cb T C 14: 20,531,799 I49M probably benign Het
Prr14l A C 5: 32,828,736 C1138W Het
Psg22 T A 7: 18,726,886 I480K probably damaging Het
Rgs21 A C 1: 144,536,915 F57C Het
Rngtt T A 4: 33,404,218 D468E probably damaging Het
Rorb A T 19: 18,957,322 V313E probably damaging Het
Sdk2 A G 11: 113,806,377 F1736S probably damaging Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Slitrk1 T C 14: 108,911,549 I577V Het
Sos2 C A 12: 69,586,672 E1143D possibly damaging Het
Spen T C 4: 141,522,312 D55G unknown Het
Stoml1 C A 9: 58,260,953 Q316K possibly damaging Het
Synpo2l C T 14: 20,665,789 A243T probably damaging Het
Tenm4 A T 7: 96,823,918 I974F possibly damaging Het
Trp53bp1 T A 2: 121,236,611 I545F possibly damaging Het
Unc13a T C 8: 71,652,350 D756G possibly damaging Het
Vcl T A 14: 21,007,276 D505E probably benign Het
Wdr11 A G 7: 129,603,092 H207R Het
Zc3h7b A G 15: 81,769,111 D72G probably damaging Het
Zfp507 A T 7: 35,776,458 D813E probably damaging Het
Zfp704 T C 3: 9,444,264 S374G probably benign Het
Zfp97 G A 17: 17,144,953 C238Y probably benign Het
Other mutations in Uqcrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Uqcrc1 APN 9 108948958 missense possibly damaging 0.62
IGL02332:Uqcrc1 APN 9 108947869 missense probably damaging 1.00
IGL02698:Uqcrc1 APN 9 108947943 critical splice donor site probably null
R0313:Uqcrc1 UTSW 9 108948574 missense possibly damaging 0.69
R0743:Uqcrc1 UTSW 9 108944705 nonsense probably null
R2027:Uqcrc1 UTSW 9 108947015 missense probably benign 0.06
R2513:Uqcrc1 UTSW 9 108936768 missense probably damaging 1.00
R4680:Uqcrc1 UTSW 9 108947861 missense probably damaging 1.00
R4993:Uqcrc1 UTSW 9 108944810 missense probably damaging 1.00
R5223:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R5716:Uqcrc1 UTSW 9 108947405 missense probably benign
R5941:Uqcrc1 UTSW 9 108947486 unclassified probably benign
R6274:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R6598:Uqcrc1 UTSW 9 108947622 missense possibly damaging 0.93
R7132:Uqcrc1 UTSW 9 108949468 missense probably damaging 0.98
R7150:Uqcrc1 UTSW 9 108947858 missense probably benign 0.02
R7524:Uqcrc1 UTSW 9 108936759 missense possibly damaging 0.48
R8708:Uqcrc1 UTSW 9 108947040 missense probably damaging 0.97
R8889:Uqcrc1 UTSW 9 108937118 missense probably damaging 1.00
R8892:Uqcrc1 UTSW 9 108937118 missense probably damaging 1.00
R8975:Uqcrc1 UTSW 9 108947653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTCCTGCAAGGCCAGTG -3'
(R):5'- TTGCACCTGAAGCTCCAAAC -3'

Sequencing Primer
(F):5'- AAGGCCAGTGGTGAGTCTC -3'
(R):5'- TTGATAAGTAGACCAAGCTGGCCTC -3'
Posted On 2022-01-20