Incidental Mutation 'R9136:Cd70'
ID 694057
Institutional Source Beutler Lab
Gene Symbol Cd70
Ensembl Gene ENSMUSG00000019489
Gene Name CD70 antigen
Synonyms Ki-24 antigen, CD27LG, Tnfsf7
MMRRC Submission 068931-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9136 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 57452997-57456777 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57453152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 171 (T171A)
Ref Sequence ENSEMBL: ENSMUSP00000019633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019633]
AlphaFold O55237
Predicted Effect possibly damaging
Transcript: ENSMUST00000019633
AA Change: T171A

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019633
Gene: ENSMUSG00000019489
AA Change: T171A

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
TNF 63 193 2.08e-16 SMART
Meta Mutation Damage Score 0.2048 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27/CD27. It is a surface antigen on activated, but not on resting, T and B lymphocytes. It induces proliferation of costimulated T cells, enhances the generation of cytolytic T cells, and contributes to T cell activation. This cytokine is also reported to play a role in regulating B-cell activation, cytotoxic function of natural killer cells, and immunoglobulin sythesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Expansion of CD8+ cells after viral expansion is significantly less in mice with a homozygous deletion than in controls. However, the restimulation response is comparable to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A G 17: 24,596,807 (GRCm39) Q420R probably benign Het
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Acsl5 A T 19: 55,266,400 (GRCm39) K109N probably benign Het
Agpat3 T C 10: 78,120,893 (GRCm39) N95S probably damaging Het
Akna C T 4: 63,310,392 (GRCm39) D451N probably damaging Het
Ankrd17 A T 5: 90,392,278 (GRCm39) D1797E probably damaging Het
Ano2 A G 6: 125,959,962 (GRCm39) N691S probably damaging Het
Arrdc1 A T 2: 24,817,193 (GRCm39) probably benign Het
Ccdc63 G A 5: 122,259,146 (GRCm39) R251W probably damaging Het
Cenpf A T 1: 189,403,352 (GRCm39) S382T probably benign Het
Cox5b-ps A C 13: 21,685,587 (GRCm39) M1R probably null Het
Ddx19b G T 8: 111,734,906 (GRCm39) D487E probably benign Het
Dlgap4 G A 2: 156,588,075 (GRCm39) E640K possibly damaging Het
Dtnbp1 A T 13: 45,084,546 (GRCm39) F198Y possibly damaging Het
Epha10 T C 4: 124,796,427 (GRCm39) Y379H Het
Eral1 A G 11: 77,964,960 (GRCm39) I411T Het
Exd1 C T 2: 119,359,385 (GRCm39) G193E probably damaging Het
Fat3 C A 9: 15,833,738 (GRCm39) A105S Het
Fbp2 C T 13: 63,002,840 (GRCm39) V71M possibly damaging Het
Gm10801 C CGTA 2: 98,494,152 (GRCm39) probably null Het
Grm5 G A 7: 87,689,254 (GRCm39) V542I possibly damaging Het
Hdc C T 2: 126,439,786 (GRCm39) probably null Het
Hspe1 G T 1: 55,128,314 (GRCm39) K36N probably damaging Het
Hypk T A 2: 121,287,636 (GRCm39) L17* probably null Het
Il18rap C T 1: 40,582,177 (GRCm39) T366M probably benign Het
Immt C T 6: 71,851,403 (GRCm39) T588I probably damaging Het
Kat2b T A 17: 53,936,364 (GRCm39) S179T probably benign Het
Krtap19-5 C T 16: 88,693,246 (GRCm39) G22D unknown Het
Lipk A G 19: 33,999,830 (GRCm39) D153G probably damaging Het
Lnpep A G 17: 17,750,090 (GRCm39) V1000A probably benign Het
Map3k7cl T C 16: 87,391,227 (GRCm39) L117P probably damaging Het
Meikin A G 11: 54,285,464 (GRCm39) E167G possibly damaging Het
Miox A G 15: 89,220,740 (GRCm39) Y215C probably damaging Het
Mthfd1 T G 12: 76,350,649 (GRCm39) M677R probably damaging Het
Ncoa7 G A 10: 30,567,628 (GRCm39) S350L probably benign Het
Nox4 G A 7: 87,025,448 (GRCm39) R525Q probably benign Het
Nrg3 A T 14: 38,119,262 (GRCm39) N403K possibly damaging Het
Nup210 T C 6: 91,020,830 (GRCm39) T955A possibly damaging Het
Odf2l C A 3: 144,851,698 (GRCm39) T82K Het
Or10ag56 A G 2: 87,139,219 (GRCm39) I49V possibly damaging Het
Or1m1 T C 9: 18,666,175 (GRCm39) Y252C probably damaging Het
Or4c108 T A 2: 88,804,113 (GRCm39) M41L probably benign Het
Or8w1 A G 2: 87,465,341 (GRCm39) V250A probably benign Het
Otud7b T A 3: 96,059,815 (GRCm39) probably benign Het
Pcm1 C T 8: 41,732,825 (GRCm39) S694L probably benign Het
Pex11b T C 3: 96,551,259 (GRCm39) L248P probably damaging Het
Pira13 A T 7: 3,826,285 (GRCm39) I236N Het
Ppp3cb T C 14: 20,581,867 (GRCm39) I49M probably benign Het
Prorp C T 12: 55,350,727 (GRCm39) P12L probably benign Het
Prr14l A C 5: 32,986,080 (GRCm39) C1138W Het
Prss1 T G 6: 41,438,280 (GRCm39) probably benign Het
Psg22 T A 7: 18,460,811 (GRCm39) I480K probably damaging Het
Rgs21 A C 1: 144,412,653 (GRCm39) F57C Het
Rngtt T A 4: 33,404,218 (GRCm39) D468E probably damaging Het
Rorb A T 19: 18,934,686 (GRCm39) V313E probably damaging Het
Sdk2 A G 11: 113,697,203 (GRCm39) F1736S probably damaging Het
Sertad2 A T 11: 20,598,425 (GRCm39) E207V probably benign Het
Slitrk1 T C 14: 109,148,981 (GRCm39) I577V Het
Sos2 C A 12: 69,633,446 (GRCm39) E1143D possibly damaging Het
Spen T C 4: 141,249,623 (GRCm39) D55G unknown Het
Stoml1 C A 9: 58,168,236 (GRCm39) Q316K possibly damaging Het
Synpo2l C T 14: 20,715,857 (GRCm39) A243T probably damaging Het
Tenm4 A T 7: 96,473,125 (GRCm39) I974F possibly damaging Het
Trp53bp1 T A 2: 121,067,092 (GRCm39) I545F possibly damaging Het
Unc13a T C 8: 72,104,994 (GRCm39) D756G possibly damaging Het
Uqcrc1 A G 9: 108,776,973 (GRCm39) N393D possibly damaging Het
Vcl T A 14: 21,057,344 (GRCm39) D505E probably benign Het
Vwf A T 6: 125,576,356 (GRCm39) probably benign Het
Wdr11 A G 7: 129,204,816 (GRCm39) H207R Het
Zc3h7b A G 15: 81,653,312 (GRCm39) D72G probably damaging Het
Zfp507 A T 7: 35,475,883 (GRCm39) D813E probably damaging Het
Zfp704 T C 3: 9,509,324 (GRCm39) S374G probably benign Het
Zfp97 G A 17: 17,365,215 (GRCm39) C238Y probably benign Het
Other mutations in Cd70
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1575:Cd70 UTSW 17 57,453,364 (GRCm39) missense probably damaging 0.97
R1723:Cd70 UTSW 17 57,453,401 (GRCm39) missense possibly damaging 0.55
R4998:Cd70 UTSW 17 57,453,311 (GRCm39) missense probably damaging 1.00
R6602:Cd70 UTSW 17 57,456,562 (GRCm39) missense probably benign 0.00
R6948:Cd70 UTSW 17 57,456,594 (GRCm39) missense probably damaging 1.00
R7871:Cd70 UTSW 17 57,455,770 (GRCm39) missense probably damaging 1.00
R8474:Cd70 UTSW 17 57,456,468 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGAAACCCATCAGTGCGGAG -3'
(R):5'- TGCATATCCAGGTGACACTG -3'

Sequencing Primer
(F):5'- GATGGAAGGAAGTATCAGCCAAC -3'
(R):5'- AGGTGACACTGGCCAACTG -3'
Posted On 2022-01-20