Incidental Mutation 'R9137:St8sia2'
ID 694085
Institutional Source Beutler Lab
Gene Symbol St8sia2
Ensembl Gene ENSMUSG00000025789
Gene Name ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Synonyms Siat8b, ST8SiaII
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_009181.2; MGI:106020

Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R9137 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 73939119-74013690 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 73960906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 210 (I210L)
Ref Sequence ENSEMBL: ENSMUSP00000026896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026896] [ENSMUST00000191970]
AlphaFold O35696
Predicted Effect probably benign
Transcript: ENSMUST00000026896
AA Change: I210L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026896
Gene: ENSMUSG00000025789
AA Change: I210L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glyco_transf_29 109 369 2.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191970
AA Change: I189L

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141307
Gene: ENSMUSG00000025789
AA Change: I189L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
Pfam:Glyco_transf_29 84 206 5.8e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype Strain: 3051219
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that is thought to catalyze the transfer of sialic acid from CMP-sialic acid to N-linked oligosaccharides and glycoproteins. The encoded protein may be found in the Golgi apparatus and may be involved in the production of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). This protein is a member of glycosyltransferase family 29. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal mossy fiber morphology, increased exploration in new environment and impaired fear responses. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,867,448 K299R probably benign Het
4931408C20Rik A T 1: 26,685,634 I155N probably benign Het
Abca12 T G 1: 71,259,366 I2366L possibly damaging Het
Adgrv1 A G 13: 81,540,014 V1749A probably damaging Het
Ano9 C T 7: 141,104,115 V546M probably damaging Het
Atad5 A T 11: 80,095,655 S523C probably damaging Het
Cacna1s A T 1: 136,069,006 D115V possibly damaging Het
Ccdc18 T G 5: 108,148,990 C220G probably damaging Het
Cfap61 A C 2: 146,200,765 K1153Q probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cntnap5c T A 17: 58,294,208 probably benign Het
Col11a1 A G 3: 114,061,523 K144R unknown Het
Cr2 A G 1: 195,168,332 probably null Het
Cyp3a16 A C 5: 145,469,603 V13G unknown Het
E330034G19Rik A G 14: 24,296,041 N72D unknown Het
Enah A G 1: 181,911,595 probably null Het
Fezf1 T A 6: 23,246,512 probably benign Het
Gabrr2 T A 4: 33,095,571 S487T probably benign Het
Gas2l2 G A 11: 83,425,068 T275M probably damaging Het
Hectd4 A G 5: 121,358,175 K3877E possibly damaging Het
Hhla1 G T 15: 65,923,912 Q482K probably damaging Het
Hivep2 A G 10: 14,128,968 T437A probably benign Het
Iars C T 13: 49,701,874 T259M probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itpk1 T C 12: 102,574,032 E264G probably benign Het
Katnb1 G A 8: 95,097,692 M501I possibly damaging Het
Kcna10 G A 3: 107,195,181 G376E probably damaging Het
Kif23 A T 9: 61,927,431 F397I probably damaging Het
Klf14 A T 6: 30,957,920 C260S probably damaging Het
Lgi2 T A 5: 52,538,019 S533C probably damaging Het
Marveld1 A G 19: 42,148,001 D118G probably benign Het
Msln C T 17: 25,750,110 A434T probably benign Het
Neb T C 2: 52,260,490 probably benign Het
Nes G T 3: 87,971,344 G48W probably damaging Het
Olfr195 T A 16: 59,149,272 C141S probably benign Het
Osmr T A 15: 6,827,228 E479D probably benign Het
Otop3 A G 11: 115,345,042 H500R possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phldb3 C T 7: 24,611,298 probably benign Het
Ppp4r3a T A 12: 101,055,535 I369F possibly damaging Het
Rarres1 T A 3: 67,515,468 probably benign Het
Scn4a A G 11: 106,323,910 V1287A probably damaging Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Sh3bp4 T A 1: 89,144,925 C498* probably null Het
Smtn T G 11: 3,522,838 K278T possibly damaging Het
Sp140 T C 1: 85,642,576 S405P probably damaging Het
Spem1 A G 11: 69,821,607 V77A probably benign Het
Stkld1 T C 2: 26,950,560 I418T probably benign Het
Tpcn1 A G 5: 120,557,925 F88L probably damaging Het
Trim66 C T 7: 109,475,123 V644M probably damaging Het
Ttc41 T C 10: 86,776,622 I1253T probably benign Het
Vmn2r86 T C 10: 130,446,540 N736D probably damaging Het
Zfat T A 15: 68,179,945 T667S probably benign Het
Zfp874a T C 13: 67,442,722 E281G probably damaging Het
Other mutations in St8sia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02161:St8sia2 APN 7 73976682 missense probably benign 0.00
IGL02261:St8sia2 APN 7 73966846 missense probably damaging 1.00
IGL02941:St8sia2 APN 7 73976649 intron probably benign
IGL02971:St8sia2 APN 7 73966811 missense probably damaging 1.00
BB001:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
BB011:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
IGL03147:St8sia2 UTSW 7 73966819 missense probably damaging 1.00
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73971952 missense probably damaging 1.00
R0733:St8sia2 UTSW 7 73960840 missense probably benign
R1202:St8sia2 UTSW 7 73972035 missense probably benign 0.43
R1419:St8sia2 UTSW 7 73966994 nonsense probably null
R1962:St8sia2 UTSW 7 73943309 missense probably damaging 1.00
R2051:St8sia2 UTSW 7 73943202 missense possibly damaging 0.91
R4106:St8sia2 UTSW 7 73960761 missense probably damaging 1.00
R4989:St8sia2 UTSW 7 73966961 missense possibly damaging 0.75
R5541:St8sia2 UTSW 7 73966900 missense probably benign 0.00
R5859:St8sia2 UTSW 7 73966906 missense probably damaging 1.00
R6029:St8sia2 UTSW 7 73960710 missense possibly damaging 0.96
R6260:St8sia2 UTSW 7 73976693 missense possibly damaging 0.56
R6416:St8sia2 UTSW 7 73971921 missense probably damaging 1.00
R7371:St8sia2 UTSW 7 73966927 missense probably damaging 0.99
R7424:St8sia2 UTSW 7 73960902 missense possibly damaging 0.66
R7763:St8sia2 UTSW 7 73943321 missense probably damaging 1.00
R7924:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
R8688:St8sia2 UTSW 7 73943344 missense probably damaging 1.00
R9139:St8sia2 UTSW 7 73966765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTCACATGGTGCTTCAGG -3'
(R):5'- GCTCAGTAAACATTTGAGGCAG -3'

Sequencing Primer
(F):5'- CTTCAGGATGAGAGCATTGACCC -3'
(R):5'- CATGAAGTATCCTGCATCTCTGAGG -3'
Posted On 2022-01-20