Incidental Mutation 'R9137:Ano9'
ID 694087
Institutional Source Beutler Lab
Gene Symbol Ano9
Ensembl Gene ENSMUSG00000054662
Gene Name anoctamin 9
Synonyms 5430425C04Rik, Tmem16j, Trp53i5, Tp53i5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9137 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 141101212-141117806 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 141104115 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 546 (V546M)
Ref Sequence ENSEMBL: ENSMUSP00000067689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067836] [ENSMUST00000097958] [ENSMUST00000209294] [ENSMUST00000210167]
AlphaFold P86044
Predicted Effect probably damaging
Transcript: ENSMUST00000067836
AA Change: V546M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067689
Gene: ENSMUSG00000054662
AA Change: V546M

DomainStartEndE-ValueType
Pfam:Anoctamin 174 730 3.3e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097958
SMART Domains Protein: ENSMUSP00000095571
Gene: ENSMUSG00000025494

DomainStartEndE-ValueType
IG 17 112 5.21e-2 SMART
transmembrane domain 117 139 N/A INTRINSIC
Pfam:TIR 163 327 2.2e-19 PFAM
Pfam:TIR_2 166 308 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209294
Predicted Effect probably benign
Transcript: ENSMUST00000210167
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TMEM16 (anoctamin) family of proteins, some of which form integral membrane calcium-activated chloride channels. The function of the encoded protein has yet to be elucidated, although it may have channel-forming abilities and also may have phospholipid scramblase activity. This gene has been observed to be upregulated in stage II and III colorectal cancers. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,867,448 K299R probably benign Het
4931408C20Rik A T 1: 26,685,634 I155N probably benign Het
Abca12 T G 1: 71,259,366 I2366L possibly damaging Het
Adgrv1 A G 13: 81,540,014 V1749A probably damaging Het
Atad5 A T 11: 80,095,655 S523C probably damaging Het
Cacna1s A T 1: 136,069,006 D115V possibly damaging Het
Ccdc18 T G 5: 108,148,990 C220G probably damaging Het
Cfap61 A C 2: 146,200,765 K1153Q probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cntnap5c T A 17: 58,294,208 probably benign Het
Col11a1 A G 3: 114,061,523 K144R unknown Het
Cr2 A G 1: 195,168,332 probably null Het
Cyp3a16 A C 5: 145,469,603 V13G unknown Het
E330034G19Rik A G 14: 24,296,041 N72D unknown Het
Enah A G 1: 181,911,595 probably null Het
Fezf1 T A 6: 23,246,512 probably benign Het
Gabrr2 T A 4: 33,095,571 S487T probably benign Het
Gas2l2 G A 11: 83,425,068 T275M probably damaging Het
Hectd4 A G 5: 121,358,175 K3877E possibly damaging Het
Hhla1 G T 15: 65,923,912 Q482K probably damaging Het
Hivep2 A G 10: 14,128,968 T437A probably benign Het
Iars C T 13: 49,701,874 T259M probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itpk1 T C 12: 102,574,032 E264G probably benign Het
Katnb1 G A 8: 95,097,692 M501I possibly damaging Het
Kcna10 G A 3: 107,195,181 G376E probably damaging Het
Kif23 A T 9: 61,927,431 F397I probably damaging Het
Klf14 A T 6: 30,957,920 C260S probably damaging Het
Lgi2 T A 5: 52,538,019 S533C probably damaging Het
Marveld1 A G 19: 42,148,001 D118G probably benign Het
Msln C T 17: 25,750,110 A434T probably benign Het
Neb T C 2: 52,260,490 probably benign Het
Nes G T 3: 87,971,344 G48W probably damaging Het
Olfr195 T A 16: 59,149,272 C141S probably benign Het
Osmr T A 15: 6,827,228 E479D probably benign Het
Otop3 A G 11: 115,345,042 H500R possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phldb3 C T 7: 24,611,298 probably benign Het
Ppp4r3a T A 12: 101,055,535 I369F possibly damaging Het
Rarres1 T A 3: 67,515,468 probably benign Het
Scn4a A G 11: 106,323,910 V1287A probably damaging Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Sh3bp4 T A 1: 89,144,925 C498* probably null Het
Smtn T G 11: 3,522,838 K278T possibly damaging Het
Sp140 T C 1: 85,642,576 S405P probably damaging Het
Spem1 A G 11: 69,821,607 V77A probably benign Het
St8sia2 T G 7: 73,960,906 I210L probably benign Het
Stkld1 T C 2: 26,950,560 I418T probably benign Het
Tpcn1 A G 5: 120,557,925 F88L probably damaging Het
Trim66 C T 7: 109,475,123 V644M probably damaging Het
Ttc41 T C 10: 86,776,622 I1253T probably benign Het
Vmn2r86 T C 10: 130,446,540 N736D probably damaging Het
Zfat T A 15: 68,179,945 T667S probably benign Het
Zfp874a T C 13: 67,442,722 E281G probably damaging Het
Other mutations in Ano9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ano9 APN 7 141102042 nonsense probably null
IGL01620:Ano9 APN 7 141110439 missense probably damaging 1.00
IGL02045:Ano9 APN 7 141102469 missense probably benign 0.00
IGL02506:Ano9 APN 7 141102254 unclassified probably benign
IGL02657:Ano9 APN 7 141107440 missense probably damaging 1.00
IGL02731:Ano9 APN 7 141107204 missense probably damaging 1.00
IGL02863:Ano9 APN 7 141108651 missense probably benign 0.00
R0114:Ano9 UTSW 7 141103239 unclassified probably benign
R0374:Ano9 UTSW 7 141107814 missense probably damaging 0.98
R0487:Ano9 UTSW 7 141107849 missense possibly damaging 0.85
R0600:Ano9 UTSW 7 141104710 missense probably damaging 1.00
R0702:Ano9 UTSW 7 141107282 missense probably damaging 1.00
R0765:Ano9 UTSW 7 141107184 missense probably damaging 1.00
R1679:Ano9 UTSW 7 141108297 missense probably benign 0.03
R1773:Ano9 UTSW 7 141108378 missense possibly damaging 0.95
R1809:Ano9 UTSW 7 141108804 missense possibly damaging 0.93
R1883:Ano9 UTSW 7 141102331 missense probably benign
R2034:Ano9 UTSW 7 141108135 missense probably damaging 0.99
R2159:Ano9 UTSW 7 141108117 missense probably benign 0.01
R2254:Ano9 UTSW 7 141103090 missense probably benign
R2293:Ano9 UTSW 7 141102515 missense probably benign
R3177:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R3277:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R4274:Ano9 UTSW 7 141110695 missense probably benign
R4576:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4577:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4872:Ano9 UTSW 7 141107204 missense probably damaging 1.00
R4879:Ano9 UTSW 7 141110502 missense probably benign 0.23
R5160:Ano9 UTSW 7 141104365 missense probably damaging 1.00
R5560:Ano9 UTSW 7 141110482 missense probably damaging 1.00
R6148:Ano9 UTSW 7 141106785 missense probably damaging 1.00
R6302:Ano9 UTSW 7 141104308 missense probably damaging 1.00
R6821:Ano9 UTSW 7 141107256 missense possibly damaging 0.70
R7253:Ano9 UTSW 7 141107437 missense probably damaging 0.96
R7479:Ano9 UTSW 7 141102435 missense probably damaging 0.99
R7836:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R7942:Ano9 UTSW 7 141104076 missense probably damaging 0.96
R8051:Ano9 UTSW 7 141104532 missense probably damaging 1.00
R8341:Ano9 UTSW 7 141102334 missense possibly damaging 0.94
R8690:Ano9 UTSW 7 141104307 missense probably benign 0.26
R9355:Ano9 UTSW 7 141101904 missense probably benign 0.00
R9521:Ano9 UTSW 7 141102314 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGTGAAAAGCCCAGGATTG -3'
(R):5'- AGTGGCAGCGTAACTACTAC -3'

Sequencing Primer
(F):5'- GAAGTTGCTCTTCCCAGCG -3'
(R):5'- GTGGCAGCGTAACTACTACATGAATC -3'
Posted On 2022-01-20