Incidental Mutation 'R9137:Ttc41'
ID 694091
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9137 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86776622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1253 (I1253T)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000099396]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: I1253T

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: I1253T

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099396
SMART Domains Protein: ENSMUSP00000096994
Gene: ENSMUSG00000054027

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:5_nucleotid 83 526 1.8e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218802
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,867,448 K299R probably benign Het
4931408C20Rik A T 1: 26,685,634 I155N probably benign Het
Abca12 T G 1: 71,259,366 I2366L possibly damaging Het
Adgrv1 A G 13: 81,540,014 V1749A probably damaging Het
Ano9 C T 7: 141,104,115 V546M probably damaging Het
Atad5 A T 11: 80,095,655 S523C probably damaging Het
Cacna1s A T 1: 136,069,006 D115V possibly damaging Het
Ccdc18 T G 5: 108,148,990 C220G probably damaging Het
Cfap61 A C 2: 146,200,765 K1153Q probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Col11a1 A G 3: 114,061,523 K144R unknown Het
Cr2 A G 1: 195,168,332 probably null Het
Cyp3a16 A C 5: 145,469,603 V13G unknown Het
E330034G19Rik A G 14: 24,296,041 N72D unknown Het
Enah A G 1: 181,911,595 probably null Het
Gabrr2 T A 4: 33,095,571 S487T probably benign Het
Gas2l2 G A 11: 83,425,068 T275M probably damaging Het
Hectd4 A G 5: 121,358,175 K3877E possibly damaging Het
Hhla1 G T 15: 65,923,912 Q482K probably damaging Het
Hivep2 A G 10: 14,128,968 T437A probably benign Het
Iars C T 13: 49,701,874 T259M probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itpk1 T C 12: 102,574,032 E264G probably benign Het
Katnb1 G A 8: 95,097,692 M501I possibly damaging Het
Kcna10 G A 3: 107,195,181 G376E probably damaging Het
Kif23 A T 9: 61,927,431 F397I probably damaging Het
Klf14 A T 6: 30,957,920 C260S probably damaging Het
Lgi2 T A 5: 52,538,019 S533C probably damaging Het
Marveld1 A G 19: 42,148,001 D118G probably benign Het
Msln C T 17: 25,750,110 A434T probably benign Het
Nes G T 3: 87,971,344 G48W probably damaging Het
Olfr195 T A 16: 59,149,272 C141S probably benign Het
Osmr T A 15: 6,827,228 E479D probably benign Het
Otop3 A G 11: 115,345,042 H500R possibly damaging Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,659,272 probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phldb3 C T 7: 24,611,298 probably benign Het
Ppp4r3a T A 12: 101,055,535 I369F possibly damaging Het
Rarres1 T A 3: 67,515,468 probably benign Het
Scn4a A G 11: 106,323,910 V1287A probably damaging Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Sh3bp4 T A 1: 89,144,925 C498* probably null Het
Smtn T G 11: 3,522,838 K278T possibly damaging Het
Sp140 T C 1: 85,642,576 S405P probably damaging Het
Spem1 A G 11: 69,821,607 V77A probably benign Het
St8sia2 T G 7: 73,960,906 I210L probably benign Het
Stkld1 T C 2: 26,950,560 I418T probably benign Het
Tpcn1 A G 5: 120,557,925 F88L probably damaging Het
Trim66 C T 7: 109,475,123 V644M probably damaging Het
Vmn2r86 T C 10: 130,446,540 N736D probably damaging Het
Zfat T A 15: 68,179,945 T667S probably benign Het
Zfp874a T C 13: 67,442,722 E281G probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAACGTCAGGCTTCAGACTC -3'
(R):5'- TGTGCACACTTGTACCACAC -3'

Sequencing Primer
(F):5'- GTCAGGCTTCAGACTCACAAATATGG -3'
(R):5'- CATACGCCTTTCAAGAGAAATGAG -3'
Posted On 2022-01-20