Mutagenetix > Incidental Mutation

Incidental Mutation 'V7580:Numbl'

69413

Institutional Source

Beutler Lab

Gene Symbol

Numbl

Ensembl Gene

ENSMUSG00000063160

Gene Name

numb-like

Synonyms

nbl

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

V7580 () of strain stinger

Quality Score

193

Status

Not validated

Chromosome

Chromosomal Location

27258433-27282144 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27279602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 379 (S379P)

Ref Sequence

ENSEMBL: ENSMUSP00000078245 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079258]

AlphaFold

O08919

Predicted Effect

probably benign
Transcript: ENSMUST00000079258
AA Change: S379P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078245
Gene: ENSMUSG00000063160
AA Change: S379P

Domain	Start	End	E-Value	Type
PTB	75	205	1.11e-38	SMART
low complexity region	234	260	N/A	INTRINSIC
Pfam:NumbF	287	371	3.5e-32	PFAM
coiled coil region	417	444	N/A	INTRINSIC
low complexity region	532	574	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134215

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149805

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypes except for a reduction in female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Med20	G	A	17: 47,618,832	V65M	probably damaging	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Numbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00976:Numbl	APN	7	27268810	missense	possibly damaging	0.50
IGL01389:Numbl	APN	7	27281047	missense	possibly damaging	0.94
IGL02671:Numbl	APN	7	27264902	missense	probably damaging	1.00
F5770:Numbl	UTSW	7	27279602	missense	probably benign
R0212:Numbl	UTSW	7	27280759	missense	probably damaging	1.00
R0709:Numbl	UTSW	7	27273990	missense	probably damaging	1.00
R1768:Numbl	UTSW	7	27280954	missense	probably benign
R2181:Numbl	UTSW	7	27268921	critical splice donor site	probably null
R5071:Numbl	UTSW	7	27280990	missense	probably damaging	1.00
R5072:Numbl	UTSW	7	27280990	missense	probably damaging	1.00
R5074:Numbl	UTSW	7	27280990	missense	probably damaging	1.00
R6134:Numbl	UTSW	7	27281314	missense	probably damaging	0.98
R6387:Numbl	UTSW	7	27276690	missense	probably damaging	0.99
R6989:Numbl	UTSW	7	27280840	missense	probably damaging	1.00
R7510:Numbl	UTSW	7	27271987	splice site	probably null
R8093:Numbl	UTSW	7	27281036	missense	possibly damaging	0.52
R8518:Numbl	UTSW	7	27264936	missense	probably benign	0.12
R9449:Numbl	UTSW	7	27276902	missense
V7583:Numbl	UTSW	7	27279602	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCATCGGTTATCAGATGCCACCTAC -3'
(R):5'- TGGTCCCACAGTCCTAAGGCAATAC -3'

Sequencing Primer
(F):5'- GTGACCTATGTACCTCTGGAAGAC -3'
(R):5'- GTCCTAAGGCAATACAGTGGTTC -3'

Posted On

2013-09-04