Incidental Mutation 'R9138:Spen'
ID 694134
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Name spen family transcription repressor
Synonyms Mint
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9138 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 141467890-141538597 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141469486 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3566 (D3566G)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006377
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078886
AA Change: D3543G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: D3543G

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105786
AA Change: D3566G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: D3566G

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C T 1: 26,682,172 C1309Y possibly damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adgre5 A T 8: 83,725,934 N502K probably benign Het
Ago4 T A 4: 126,520,280 K73* probably null Het
Angpt2 T C 8: 18,714,146 I127V probably benign Het
Ankhd1 TGGCGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGC 18: 36,560,908 probably benign Het
Ap4b1 T A 3: 103,815,310 I368N probably damaging Het
Arhgap5 A G 12: 52,562,363 I1374V probably benign Het
BC053393 A T 11: 46,577,299 T67S probably damaging Het
Caln1 T C 5: 130,669,608 L157P probably damaging Het
Cdh9 G T 15: 16,823,187 G85V probably damaging Het
Chrna4 A G 2: 181,028,982 V327A probably damaging Het
Col11a2 T C 17: 34,060,873 S1156P Het
Cps1 G A 1: 67,215,410 V1253M probably damaging Het
Crb1 T C 1: 139,234,730 E1291G Het
Dab1 A T 4: 104,731,732 K518* probably null Het
Ddias A T 7: 92,858,400 I769N possibly damaging Het
Dlg5 G T 14: 24,245,308 A48E probably damaging Het
Dok1 G T 6: 83,032,825 A101E probably damaging Het
Dpf2 T C 19: 5,898,565 N389S probably benign Het
Evi5l T A 8: 4,183,582 S22T probably benign Het
Fam71e2 A G 7: 4,770,407 F137S Het
Gm34653 T C 2: 34,838,908 Y240H probably damaging Het
Gm5431 T A 11: 48,889,671 R141S probably benign Het
Gmds A T 13: 32,127,052 Y197* probably null Het
Gprc5a T A 6: 135,079,166 S204T probably damaging Het
Hist1h2ba T C 13: 23,934,129 T10A probably benign Het
Hoxd12 T A 2: 74,675,558 S158T probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Kif16b C A 2: 142,700,556 E273D Het
Lct T C 1: 128,300,157 I1200V probably benign Het
Lrrfip1 T A 1: 91,110,358 L398I probably damaging Het
Mcm4 T C 16: 15,629,336 E588G probably damaging Het
Mdga2 C T 12: 66,568,889 G648D possibly damaging Het
Mfrp A G 9: 44,106,376 Q555R possibly damaging Het
Mtf1 C T 4: 124,838,717 Q523* probably null Het
Naf1 A G 8: 66,864,546 D230G possibly damaging Het
Nbeal1 G T 1: 60,247,745 E909* probably null Het
Nxt1 C A 2: 148,675,652 N104K probably benign Het
Ocstamp T A 2: 165,395,944 T467S probably benign Het
Olfr1487 T A 19: 13,619,294 M44K probably damaging Het
Olfr348 A G 2: 36,786,690 H55R probably benign Het
Olfr733 T C 14: 50,299,037 I91V probably benign Het
Pcdhgc5 A C 18: 37,820,839 T389P probably benign Het
Peak1 A T 9: 56,257,641 V1001E probably benign Het
Phf11d C A 14: 59,365,384 C9F probably benign Het
Pkd1l2 T A 8: 117,055,009 T766S probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Psg20 A T 7: 18,684,670 N57K Het
Ptpro T A 6: 137,411,115 probably null Het
Rasa1 T C 13: 85,221,516 I896V possibly damaging Het
Rasa4 T C 5: 136,102,601 L483P possibly damaging Het
Sept7 A G 9: 25,301,465 Y309C probably damaging Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Slco3a1 A T 7: 74,359,916 I217N probably damaging Het
Son C T 16: 91,655,118 T251I possibly damaging Het
Stag1 T C 9: 100,947,282 V1089A probably benign Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tax1bp1 A G 6: 52,741,973 E354G probably damaging Het
Tmem63c T C 12: 87,081,827 F542S probably damaging Het
Trav12-2 T C 14: 53,616,721 S51P probably benign Het
Uhrf1bp1l T A 10: 89,779,876 V127D probably damaging Het
Upf2 T A 2: 6,023,321 D739E unknown Het
Vmn1r193 A T 13: 22,219,674 H49Q probably damaging Het
Vmn2r11 T C 5: 109,054,038 D200G probably damaging Het
Vmn2r114 C A 17: 23,291,604 C634F probably damaging Het
Zfp444 A G 7: 6,189,691 H236R probably damaging Het
Zfp712 A G 13: 67,041,254 L403P probably damaging Het
Zmpste24 T G 4: 121,065,821 Y399S probably damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
filtered UTSW 4 141477372 missense unknown
mentholated UTSW 4 141469400 missense possibly damaging 0.78
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense possibly damaging 0.53
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7350:Spen UTSW 4 141479385 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
R7698:Spen UTSW 4 141472845 missense probably damaging 1.00
R7858:Spen UTSW 4 141488131 splice site probably null
R8033:Spen UTSW 4 141471746 missense probably benign 0.03
R8064:Spen UTSW 4 141475700 missense possibly damaging 0.53
R8159:Spen UTSW 4 141475003 missense possibly damaging 0.53
R8187:Spen UTSW 4 141472905 missense possibly damaging 0.93
R8463:Spen UTSW 4 141522279 missense unknown
R8557:Spen UTSW 4 141470370 missense probably benign 0.14
R8558:Spen UTSW 4 141470370 missense probably benign 0.14
R8672:Spen UTSW 4 141470370 missense probably benign 0.14
R8673:Spen UTSW 4 141470370 missense probably benign 0.14
R8674:Spen UTSW 4 141470370 missense probably benign 0.14
R8714:Spen UTSW 4 141488003 missense unknown
R8735:Spen UTSW 4 141469818 missense probably benign 0.32
R8762:Spen UTSW 4 141472950 missense probably damaging 1.00
R8877:Spen UTSW 4 141471826 nonsense probably null
R8878:Spen UTSW 4 141477209 missense unknown
R8937:Spen UTSW 4 141474063 missense probably damaging 1.00
R8939:Spen UTSW 4 141475658 missense possibly damaging 0.72
R8968:Spen UTSW 4 141470390 missense probably benign 0.02
R8971:Spen UTSW 4 141474578 missense possibly damaging 0.53
R9016:Spen UTSW 4 141473627 missense probably damaging 1.00
R9072:Spen UTSW 4 141476391 missense unknown
R9073:Spen UTSW 4 141476391 missense unknown
R9120:Spen UTSW 4 141472922 missense
R9136:Spen UTSW 4 141522312 missense unknown
R9150:Spen UTSW 4 141517157 missense unknown
R9225:Spen UTSW 4 141475632 missense possibly damaging 0.53
R9492:Spen UTSW 4 141471787 missense probably benign 0.26
R9537:Spen UTSW 4 141471704 missense probably benign 0.15
R9537:Spen UTSW 4 141516845 small deletion probably benign
R9602:Spen UTSW 4 141477872 missense unknown
R9609:Spen UTSW 4 141488108 missense unknown
R9686:Spen UTSW 4 141472635 missense probably benign 0.27
R9697:Spen UTSW 4 141468964 missense probably damaging 1.00
R9713:Spen UTSW 4 141517020 missense unknown
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- TATCCATGCCACCGGAAGAC -3'
(R):5'- ACTCTGCTTGGCTAGAGAGATAC -3'

Sequencing Primer
(F):5'- GAAGACCAGCCCTCCTGC -3'
(R):5'- GAGATACCTCTAGACCTCGTGTG -3'
Posted On 2022-01-20