Incidental Mutation 'R9138:Ptpro'
ID 694142
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Name protein tyrosine phosphatase, receptor type, O
Synonyms Ptpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9138 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 137252319-137463233 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 137411115 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
AlphaFold E9Q612
Predicted Effect probably null
Transcript: ENSMUST00000077115
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably null
Transcript: ENSMUST00000077115
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167002
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167679
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203914
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C T 1: 26,682,172 C1309Y possibly damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adgre5 A T 8: 83,725,934 N502K probably benign Het
Ago4 T A 4: 126,520,280 K73* probably null Het
Angpt2 T C 8: 18,714,146 I127V probably benign Het
Ankhd1 TGGCGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGC 18: 36,560,908 probably benign Het
Ap4b1 T A 3: 103,815,310 I368N probably damaging Het
Arhgap5 A G 12: 52,562,363 I1374V probably benign Het
BC053393 A T 11: 46,577,299 T67S probably damaging Het
Caln1 T C 5: 130,669,608 L157P probably damaging Het
Cdh9 G T 15: 16,823,187 G85V probably damaging Het
Chrna4 A G 2: 181,028,982 V327A probably damaging Het
Col11a2 T C 17: 34,060,873 S1156P Het
Cps1 G A 1: 67,215,410 V1253M probably damaging Het
Crb1 T C 1: 139,234,730 E1291G Het
Dab1 A T 4: 104,731,732 K518* probably null Het
Ddias A T 7: 92,858,400 I769N possibly damaging Het
Dlg5 G T 14: 24,245,308 A48E probably damaging Het
Dok1 G T 6: 83,032,825 A101E probably damaging Het
Dpf2 T C 19: 5,898,565 N389S probably benign Het
Evi5l T A 8: 4,183,582 S22T probably benign Het
Fam71e2 A G 7: 4,770,407 F137S Het
Gm34653 T C 2: 34,838,908 Y240H probably damaging Het
Gm5431 T A 11: 48,889,671 R141S probably benign Het
Gmds A T 13: 32,127,052 Y197* probably null Het
Gprc5a T A 6: 135,079,166 S204T probably damaging Het
Hist1h2ba T C 13: 23,934,129 T10A probably benign Het
Hoxd12 T A 2: 74,675,558 S158T probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Kif16b C A 2: 142,700,556 E273D Het
Lct T C 1: 128,300,157 I1200V probably benign Het
Lrrfip1 T A 1: 91,110,358 L398I probably damaging Het
Mcm4 T C 16: 15,629,336 E588G probably damaging Het
Mdga2 C T 12: 66,568,889 G648D possibly damaging Het
Mfrp A G 9: 44,106,376 Q555R possibly damaging Het
Mtf1 C T 4: 124,838,717 Q523* probably null Het
Naf1 A G 8: 66,864,546 D230G possibly damaging Het
Nbeal1 G T 1: 60,247,745 E909* probably null Het
Nxt1 C A 2: 148,675,652 N104K probably benign Het
Ocstamp T A 2: 165,395,944 T467S probably benign Het
Olfr1487 T A 19: 13,619,294 M44K probably damaging Het
Olfr348 A G 2: 36,786,690 H55R probably benign Het
Olfr733 T C 14: 50,299,037 I91V probably benign Het
Pcdhgc5 A C 18: 37,820,839 T389P probably benign Het
Peak1 A T 9: 56,257,641 V1001E probably benign Het
Phf11d C A 14: 59,365,384 C9F probably benign Het
Pkd1l2 T A 8: 117,055,009 T766S probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Psg20 A T 7: 18,684,670 N57K Het
Rasa1 T C 13: 85,221,516 I896V possibly damaging Het
Rasa4 T C 5: 136,102,601 L483P possibly damaging Het
Sept7 A G 9: 25,301,465 Y309C probably damaging Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Slco3a1 A T 7: 74,359,916 I217N probably damaging Het
Son C T 16: 91,655,118 T251I possibly damaging Het
Spen T C 4: 141,469,486 D3566G probably damaging Het
Stag1 T C 9: 100,947,282 V1089A probably benign Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tax1bp1 A G 6: 52,741,973 E354G probably damaging Het
Tmem63c T C 12: 87,081,827 F542S probably damaging Het
Trav12-2 T C 14: 53,616,721 S51P probably benign Het
Uhrf1bp1l T A 10: 89,779,876 V127D probably damaging Het
Upf2 T A 2: 6,023,321 D739E unknown Het
Vmn1r193 A T 13: 22,219,674 H49Q probably damaging Het
Vmn2r11 T C 5: 109,054,038 D200G probably damaging Het
Vmn2r114 C A 17: 23,291,604 C634F probably damaging Het
Zfp444 A G 7: 6,189,691 H236R probably damaging Het
Zfp712 A G 13: 67,041,254 L403P probably damaging Het
Zmpste24 T G 4: 121,065,821 Y399S probably damaging Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
Brau UTSW 6 137454598 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
Hoff UTSW 6 137443594 missense probably damaging 1.00
Jester UTSW 6 137449917 missense probably damaging 1.00
mann UTSW 6 137411116 splice site probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
R7019:Ptpro UTSW 6 137380478 missense probably benign
R7218:Ptpro UTSW 6 137454598 missense probably damaging 1.00
R7236:Ptpro UTSW 6 137368337 missense probably damaging 1.00
R7299:Ptpro UTSW 6 137441144 critical splice donor site probably null
R7381:Ptpro UTSW 6 137399561 missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137382649 missense probably benign 0.01
R7733:Ptpro UTSW 6 137414286 nonsense probably null
R7793:Ptpro UTSW 6 137416820 missense probably damaging 0.99
R7804:Ptpro UTSW 6 137399601 splice site probably null
R7833:Ptpro UTSW 6 137416863 nonsense probably null
R7859:Ptpro UTSW 6 137392807 critical splice donor site probably null
R7873:Ptpro UTSW 6 137430739 missense probably benign 0.44
R8042:Ptpro UTSW 6 137416883 missense possibly damaging 0.71
R8859:Ptpro UTSW 6 137426784 nonsense probably null
R8979:Ptpro UTSW 6 137368142 missense probably benign
R9309:Ptpro UTSW 6 137454658 missense probably damaging 1.00
R9420:Ptpro UTSW 6 137443935 missense probably benign 0.08
R9612:Ptpro UTSW 6 137414320 missense probably benign 0.31
R9625:Ptpro UTSW 6 137394875 missense probably damaging 1.00
R9697:Ptpro UTSW 6 137386290 missense probably damaging 1.00
R9715:Ptpro UTSW 6 137368110 missense probably damaging 0.96
Z1177:Ptpro UTSW 6 137378140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGTTACTAGTAAAAGAGTGTG -3'
(R):5'- TCGTCATGGGCATGTCTCAC -3'

Sequencing Primer
(F):5'- GTTACTAGTAAAAGAGTGTGTGCAC -3'
(R):5'- ATGGGCATGTCTCACAACTACTG -3'
Posted On 2022-01-20