Incidental Mutation 'R9138:Mdga2'
ID 694165
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms Adp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9138 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 66466060-67222549 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66568889 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 648 (G648D)
Ref Sequence ENSEMBL: ENSMUSP00000046761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
AlphaFold P60755
Predicted Effect possibly damaging
Transcript: ENSMUST00000037181
AA Change: G648D

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: G648D

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: G638D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222167
AA Change: G579D

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223141
AA Change: G579D

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C T 1: 26,682,172 C1309Y possibly damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adgre5 A T 8: 83,725,934 N502K probably benign Het
Ago4 T A 4: 126,520,280 K73* probably null Het
Angpt2 T C 8: 18,714,146 I127V probably benign Het
Ankhd1 TGGCGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGC 18: 36,560,908 probably benign Het
Ap4b1 T A 3: 103,815,310 I368N probably damaging Het
Arhgap5 A G 12: 52,562,363 I1374V probably benign Het
BC053393 A T 11: 46,577,299 T67S probably damaging Het
Caln1 T C 5: 130,669,608 L157P probably damaging Het
Cdh9 G T 15: 16,823,187 G85V probably damaging Het
Chrna4 A G 2: 181,028,982 V327A probably damaging Het
Col11a2 T C 17: 34,060,873 S1156P Het
Cps1 G A 1: 67,215,410 V1253M probably damaging Het
Crb1 T C 1: 139,234,730 E1291G Het
Dab1 A T 4: 104,731,732 K518* probably null Het
Ddias A T 7: 92,858,400 I769N possibly damaging Het
Dlg5 G T 14: 24,245,308 A48E probably damaging Het
Dok1 G T 6: 83,032,825 A101E probably damaging Het
Dpf2 T C 19: 5,898,565 N389S probably benign Het
Evi5l T A 8: 4,183,582 S22T probably benign Het
Fam71e2 A G 7: 4,770,407 F137S Het
Gm34653 T C 2: 34,838,908 Y240H probably damaging Het
Gm5431 T A 11: 48,889,671 R141S probably benign Het
Gmds A T 13: 32,127,052 Y197* probably null Het
Gprc5a T A 6: 135,079,166 S204T probably damaging Het
Hist1h2ba T C 13: 23,934,129 T10A probably benign Het
Hoxd12 T A 2: 74,675,558 S158T probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Kif16b C A 2: 142,700,556 E273D Het
Lct T C 1: 128,300,157 I1200V probably benign Het
Lrrfip1 T A 1: 91,110,358 L398I probably damaging Het
Mcm4 T C 16: 15,629,336 E588G probably damaging Het
Mfrp A G 9: 44,106,376 Q555R possibly damaging Het
Mtf1 C T 4: 124,838,717 Q523* probably null Het
Naf1 A G 8: 66,864,546 D230G possibly damaging Het
Nbeal1 G T 1: 60,247,745 E909* probably null Het
Nxt1 C A 2: 148,675,652 N104K probably benign Het
Ocstamp T A 2: 165,395,944 T467S probably benign Het
Olfr1487 T A 19: 13,619,294 M44K probably damaging Het
Olfr348 A G 2: 36,786,690 H55R probably benign Het
Olfr733 T C 14: 50,299,037 I91V probably benign Het
Pcdhgc5 A C 18: 37,820,839 T389P probably benign Het
Peak1 A T 9: 56,257,641 V1001E probably benign Het
Phf11d C A 14: 59,365,384 C9F probably benign Het
Pkd1l2 T A 8: 117,055,009 T766S probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Psg20 A T 7: 18,684,670 N57K Het
Ptpro T A 6: 137,411,115 probably null Het
Rasa1 T C 13: 85,221,516 I896V possibly damaging Het
Rasa4 T C 5: 136,102,601 L483P possibly damaging Het
Sept7 A G 9: 25,301,465 Y309C probably damaging Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Slco3a1 A T 7: 74,359,916 I217N probably damaging Het
Son C T 16: 91,655,118 T251I possibly damaging Het
Spen T C 4: 141,469,486 D3566G probably damaging Het
Stag1 T C 9: 100,947,282 V1089A probably benign Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tax1bp1 A G 6: 52,741,973 E354G probably damaging Het
Tmem63c T C 12: 87,081,827 F542S probably damaging Het
Trav12-2 T C 14: 53,616,721 S51P probably benign Het
Uhrf1bp1l T A 10: 89,779,876 V127D probably damaging Het
Upf2 T A 2: 6,023,321 D739E unknown Het
Vmn1r193 A T 13: 22,219,674 H49Q probably damaging Het
Vmn2r11 T C 5: 109,054,038 D200G probably damaging Het
Vmn2r114 C A 17: 23,291,604 C634F probably damaging Het
Zfp444 A G 7: 6,189,691 H236R probably damaging Het
Zfp712 A G 13: 67,041,254 L403P probably damaging Het
Zmpste24 T G 4: 121,065,821 Y399S probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
R8715:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R8977:Mdga2 UTSW 12 66797635 missense possibly damaging 0.88
R9177:Mdga2 UTSW 12 66470707 missense possibly damaging 0.66
R9223:Mdga2 UTSW 12 66568860 missense possibly damaging 0.81
R9248:Mdga2 UTSW 12 66689452 missense possibly damaging 0.87
R9264:Mdga2 UTSW 12 66513283 missense probably damaging 1.00
R9381:Mdga2 UTSW 12 66550530 missense possibly damaging 0.64
R9456:Mdga2 UTSW 12 66568758 missense probably benign 0.44
R9633:Mdga2 UTSW 12 66689432 missense probably benign 0.00
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66568953 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATTAAGATCCGTTGCTTTGATGGC -3'
(R):5'- TCCTCATAATTGAAAAGCCAAGGAG -3'

Sequencing Primer
(F):5'- AAGAAAGCTGCATCTCCC -3'
(R):5'- CCAAGGAGATTGCTGTTTTGAAATCC -3'
Posted On 2022-01-20