Incidental Mutation 'R9138:Mdga2'
ID 694165
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms 6720489L24Rik, Mdga2, Adp, 9330209L04Rik, Mamdc1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9138 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 66512834-67269323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66615663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 648 (G648D)
Ref Sequence ENSEMBL: ENSMUSP00000046761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
AlphaFold P60755
Predicted Effect possibly damaging
Transcript: ENSMUST00000037181
AA Change: G648D

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: G648D

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: G638D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222167
AA Change: G579D

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223141
AA Change: G579D

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Adgre5 A T 8: 84,452,563 (GRCm39) N502K probably benign Het
Ago4 T A 4: 126,414,073 (GRCm39) K73* probably null Het
Angpt2 T C 8: 18,764,162 (GRCm39) I127V probably benign Het
Ankhd1 TGGCGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGC 18: 36,693,961 (GRCm39) probably benign Het
Ap4b1 T A 3: 103,722,626 (GRCm39) I368N probably damaging Het
Arhgap5 A G 12: 52,609,146 (GRCm39) I1374V probably benign Het
B3galt9 T C 2: 34,728,920 (GRCm39) Y240H probably damaging Het
Bltp3b T A 10: 89,615,738 (GRCm39) V127D probably damaging Het
Caln1 T C 5: 130,698,449 (GRCm39) L157P probably damaging Het
Cdh9 G T 15: 16,823,273 (GRCm39) G85V probably damaging Het
Chrna4 A G 2: 180,670,775 (GRCm39) V327A probably damaging Het
Col11a2 T C 17: 34,279,847 (GRCm39) S1156P Het
Cps1 G A 1: 67,254,569 (GRCm39) V1253M probably damaging Het
Crb1 T C 1: 139,162,468 (GRCm39) E1291G Het
Dab1 A T 4: 104,588,929 (GRCm39) K518* probably null Het
Ddias A T 7: 92,507,608 (GRCm39) I769N possibly damaging Het
Dlg5 G T 14: 24,295,376 (GRCm39) A48E probably damaging Het
Dok1 G T 6: 83,009,806 (GRCm39) A101E probably damaging Het
Dpf2 T C 19: 5,948,593 (GRCm39) N389S probably benign Het
Evi5l T A 8: 4,233,582 (GRCm39) S22T probably benign Het
Garin5b A G 7: 4,773,406 (GRCm39) F137S Het
Gm5431 T A 11: 48,780,498 (GRCm39) R141S probably benign Het
Gmds A T 13: 32,311,035 (GRCm39) Y197* probably null Het
Gprc5a T A 6: 135,056,164 (GRCm39) S204T probably damaging Het
H2bc1 T C 13: 24,118,112 (GRCm39) T10A probably benign Het
Hoxd12 T A 2: 74,505,902 (GRCm39) S158T probably benign Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Idh2 TCCCAGGGCC TCC 7: 79,748,079 (GRCm39) probably null Het
Il18rap C T 1: 40,582,177 (GRCm39) T366M probably benign Het
Kif16b C A 2: 142,542,476 (GRCm39) E273D Het
Lct T C 1: 128,227,894 (GRCm39) I1200V probably benign Het
Lrrfip1 T A 1: 91,038,080 (GRCm39) L398I probably damaging Het
Mcm4 T C 16: 15,447,200 (GRCm39) E588G probably damaging Het
Mfrp A G 9: 44,017,673 (GRCm39) Q555R possibly damaging Het
Mtf1 C T 4: 124,732,510 (GRCm39) Q523* probably null Het
Naf1 A G 8: 67,317,198 (GRCm39) D230G possibly damaging Het
Nbeal1 G T 1: 60,286,904 (GRCm39) E909* probably null Het
Nxt1 C A 2: 148,517,572 (GRCm39) N104K probably benign Het
Ocstamp T A 2: 165,237,864 (GRCm39) T467S probably benign Het
Or1j19 A G 2: 36,676,702 (GRCm39) H55R probably benign Het
Or4n4b T C 14: 50,536,494 (GRCm39) I91V probably benign Het
Or5b123 T A 19: 13,596,658 (GRCm39) M44K probably damaging Het
Pcdhgc5 A C 18: 37,953,892 (GRCm39) T389P probably benign Het
Peak1 A T 9: 56,164,925 (GRCm39) V1001E probably benign Het
Phf11d C A 14: 59,602,833 (GRCm39) C9F probably benign Het
Pkd1l2 T A 8: 117,781,748 (GRCm39) T766S probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Psg20 A T 7: 18,418,595 (GRCm39) N57K Het
Ptpro T A 6: 137,388,113 (GRCm39) probably null Het
Rasa1 T C 13: 85,369,635 (GRCm39) I896V possibly damaging Het
Rasa4 T C 5: 136,131,455 (GRCm39) L483P possibly damaging Het
Septin7 A G 9: 25,212,761 (GRCm39) Y309C probably damaging Het
Sertad2 A T 11: 20,598,425 (GRCm39) E207V probably benign Het
Slco3a1 A T 7: 74,009,664 (GRCm39) I217N probably damaging Het
Son C T 16: 91,452,006 (GRCm39) T251I possibly damaging Het
Spata31e2 C T 1: 26,721,253 (GRCm39) C1309Y possibly damaging Het
Spen T C 4: 141,196,797 (GRCm39) D3566G probably damaging Het
Stag1 T C 9: 100,829,335 (GRCm39) V1089A probably benign Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tax1bp1 A G 6: 52,718,958 (GRCm39) E354G probably damaging Het
Timd6 A T 11: 46,468,126 (GRCm39) T67S probably damaging Het
Tmem63c T C 12: 87,128,601 (GRCm39) F542S probably damaging Het
Trav12-2 T C 14: 53,854,178 (GRCm39) S51P probably benign Het
Upf2 T A 2: 6,028,132 (GRCm39) D739E unknown Het
Vmn1r193 A T 13: 22,403,844 (GRCm39) H49Q probably damaging Het
Vmn2r11 T C 5: 109,201,904 (GRCm39) D200G probably damaging Het
Vmn2r114 C A 17: 23,510,578 (GRCm39) C634F probably damaging Het
Zfp444 A G 7: 6,192,690 (GRCm39) H236R probably damaging Het
Zfp712 A G 13: 67,189,318 (GRCm39) L403P probably damaging Het
Zmpste24 T G 4: 120,923,018 (GRCm39) Y399S probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66,769,883 (GRCm39) missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66,676,672 (GRCm39) splice site probably benign
IGL01843:Mdga2 APN 12 66,769,905 (GRCm39) critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66,702,197 (GRCm39) nonsense probably null
IGL02348:Mdga2 APN 12 66,597,349 (GRCm39) missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66,597,385 (GRCm39) missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66,736,206 (GRCm39) missense probably benign 0.00
IGL02901:Mdga2 APN 12 66,844,583 (GRCm39) splice site probably benign
IGL03373:Mdga2 APN 12 66,763,496 (GRCm39) missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66,844,542 (GRCm39) missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66,763,469 (GRCm39) missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66,701,894 (GRCm39) missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66,533,507 (GRCm39) missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66,769,854 (GRCm39) missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66,769,894 (GRCm39) missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66,552,876 (GRCm39) splice site probably benign
R1335:Mdga2 UTSW 12 66,763,516 (GRCm39) splice site probably null
R1382:Mdga2 UTSW 12 66,517,690 (GRCm39) missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66,844,530 (GRCm39) missense probably benign 0.01
R1521:Mdga2 UTSW 12 66,615,700 (GRCm39) missense probably benign 0.00
R1556:Mdga2 UTSW 12 66,597,367 (GRCm39) missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66,615,547 (GRCm39) nonsense probably null
R1676:Mdga2 UTSW 12 66,615,546 (GRCm39) missense probably damaging 1.00
R1698:Mdga2 UTSW 12 66,736,109 (GRCm39) missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66,533,482 (GRCm39) splice site probably benign
R2069:Mdga2 UTSW 12 66,615,691 (GRCm39) nonsense probably null
R2077:Mdga2 UTSW 12 66,702,136 (GRCm39) missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66,915,515 (GRCm39) missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66,736,155 (GRCm39) missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66,519,970 (GRCm39) splice site probably null
R2293:Mdga2 UTSW 12 66,615,759 (GRCm39) nonsense probably null
R2886:Mdga2 UTSW 12 66,553,044 (GRCm39) splice site probably benign
R2960:Mdga2 UTSW 12 66,676,752 (GRCm39) nonsense probably null
R3937:Mdga2 UTSW 12 67,267,980 (GRCm39) unclassified probably benign
R4437:Mdga2 UTSW 12 66,519,972 (GRCm39) splice site probably null
R4514:Mdga2 UTSW 12 66,763,496 (GRCm39) missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66,844,407 (GRCm39) missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66,517,775 (GRCm39) unclassified probably benign
R4744:Mdga2 UTSW 12 66,844,501 (GRCm39) missense probably benign 0.01
R4756:Mdga2 UTSW 12 66,844,427 (GRCm39) missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66,844,396 (GRCm39) splice site probably null
R5022:Mdga2 UTSW 12 66,517,534 (GRCm39) missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66,533,515 (GRCm39) missense probably benign 0.43
R5479:Mdga2 UTSW 12 66,701,950 (GRCm39) missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66,553,556 (GRCm39) missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66,701,956 (GRCm39) missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66,702,109 (GRCm39) missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66,844,537 (GRCm39) missense probably benign 0.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66,553,027 (GRCm39) missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66,676,843 (GRCm39) missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66,769,775 (GRCm39) missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66,552,889 (GRCm39) missense probably benign 0.01
R6971:Mdga2 UTSW 12 66,597,335 (GRCm39) missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66,736,158 (GRCm39) missense probably benign 0.41
R7069:Mdga2 UTSW 12 66,533,526 (GRCm39) missense probably benign 0.31
R7381:Mdga2 UTSW 12 66,615,670 (GRCm39) missense probably benign 0.44
R7474:Mdga2 UTSW 12 66,533,535 (GRCm39) nonsense probably null
R7559:Mdga2 UTSW 12 66,520,003 (GRCm39) missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66,553,029 (GRCm39) missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66,552,897 (GRCm39) missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66,736,125 (GRCm39) missense possibly damaging 0.63
R7745:Mdga2 UTSW 12 66,736,124 (GRCm39) missense probably damaging 0.99
R7852:Mdga2 UTSW 12 66,517,724 (GRCm39) missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66,702,037 (GRCm39) missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67,267,803 (GRCm39) missense unknown
R8715:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R8977:Mdga2 UTSW 12 66,844,409 (GRCm39) missense possibly damaging 0.88
R9177:Mdga2 UTSW 12 66,517,481 (GRCm39) missense possibly damaging 0.66
R9223:Mdga2 UTSW 12 66,615,634 (GRCm39) missense possibly damaging 0.81
R9248:Mdga2 UTSW 12 66,736,226 (GRCm39) missense possibly damaging 0.87
R9264:Mdga2 UTSW 12 66,560,057 (GRCm39) missense probably damaging 1.00
R9381:Mdga2 UTSW 12 66,597,304 (GRCm39) missense possibly damaging 0.64
R9456:Mdga2 UTSW 12 66,615,532 (GRCm39) missense probably benign 0.44
R9633:Mdga2 UTSW 12 66,736,206 (GRCm39) missense probably benign 0.00
Z1176:Mdga2 UTSW 12 66,736,217 (GRCm39) missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66,615,727 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATTAAGATCCGTTGCTTTGATGGC -3'
(R):5'- TCCTCATAATTGAAAAGCCAAGGAG -3'

Sequencing Primer
(F):5'- AAGAAAGCTGCATCTCCC -3'
(R):5'- CCAAGGAGATTGCTGTTTTGAAATCC -3'
Posted On 2022-01-20