Mutagenetix > Incidental Mutation

Incidental Mutation 'V7580:Pelp1'

69419

Institutional Source

Beutler Lab

Gene Symbol

Pelp1

Ensembl Gene

ENSMUSG00000018921

Gene Name

proline, glutamic acid and leucine rich protein 1

Synonyms

MNAR, 4930563C04Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

V7580 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70392883-70410031 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70398150 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 257 (T257S)

Ref Sequence

ENSEMBL: ENSMUSP00000019065 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019065] [ENSMUST00000135148]

AlphaFold

Q9DBD5

Predicted Effect

probably damaging
Transcript: ENSMUST00000019065
AA Change: T257S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000019065
Gene: ENSMUSG00000018921
AA Change: T257S

Domain	Start	End	E-Value	Type
low complexity region	2	45	N/A	INTRINSIC
Pfam:RIX1	63	232	7.5e-30	PFAM
low complexity region	264	278	N/A	INTRINSIC
low complexity region	359	386	N/A	INTRINSIC
Pfam:NUC202	424	490	8.6e-30	PFAM
Pfam:NUC202	570	644	6e-19	PFAM
low complexity region	748	758	N/A	INTRINSIC
low complexity region	797	830	N/A	INTRINSIC
low complexity region	834	863	N/A	INTRINSIC
low complexity region	869	877	N/A	INTRINSIC
SCOP:d1sig__	892	958	9e-6	SMART
low complexity region	974	989	N/A	INTRINSIC
low complexity region	993	1021	N/A	INTRINSIC
low complexity region	1070	1090	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135148

SMART Domains

Protein: ENSMUSP00000134014
Gene: ENSMUSG00000018921

Domain	Start	End	E-Value	Type
low complexity region	2	45	N/A	INTRINSIC
Pfam:RIX1	63	163	2.3e-9	PFAM

Meta Mutation Damage Score

0.0630

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which coactivates transcription of estrogen receptor responsive genes and corepresses genes activated by other hormone receptors or sequence-specific transcription factors. Expression of this gene is regulated by both members of the estrogen receptor family. This gene may be involved in the progression of several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Med20	G	A	17: 47,618,832	V65M	probably damaging	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Pelp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Pelp1	APN	11	70394812	missense	possibly damaging	0.88
IGL00819:Pelp1	APN	11	70394618	missense	unknown
IGL01017:Pelp1	APN	11	70396894	missense	probably damaging	1.00
IGL01347:Pelp1	APN	11	70395679	missense	probably damaging	1.00
IGL01460:Pelp1	APN	11	70393964	missense	unknown
IGL02022:Pelp1	APN	11	70406327	splice site	probably benign
IGL02188:Pelp1	APN	11	70409892	missense	unknown
ANU74:Pelp1	UTSW	11	70395087	missense	probably damaging	0.97
F5770:Pelp1	UTSW	11	70398150	missense	probably damaging	0.99
R0056:Pelp1	UTSW	11	70393832	missense	unknown
R0201:Pelp1	UTSW	11	70395704	missense	possibly damaging	0.84
R0637:Pelp1	UTSW	11	70395704	missense	possibly damaging	0.84
R0879:Pelp1	UTSW	11	70395297	splice site	probably benign
R1073:Pelp1	UTSW	11	70396590	missense	probably damaging	1.00
R1858:Pelp1	UTSW	11	70394742	missense	probably damaging	0.99
R1937:Pelp1	UTSW	11	70393715	splice site	probably null
R1958:Pelp1	UTSW	11	70398521	missense	probably damaging	0.99
R3613:Pelp1	UTSW	11	70395435	missense	probably benign	0.01
R3722:Pelp1	UTSW	11	70398200	missense	possibly damaging	0.62
R4176:Pelp1	UTSW	11	70396867	missense	probably damaging	1.00
R5137:Pelp1	UTSW	11	70395099	missense	probably damaging	0.98
R5253:Pelp1	UTSW	11	70401661	missense	probably damaging	1.00
R5616:Pelp1	UTSW	11	70394862	missense	possibly damaging	0.73
R5911:Pelp1	UTSW	11	70396914	missense	probably damaging	0.99
R5938:Pelp1	UTSW	11	70394867	missense	probably damaging	0.98
R6461:Pelp1	UTSW	11	70396306	missense	probably damaging	1.00
R7387:Pelp1	UTSW	11	70396599	missense	probably damaging	0.99
R7625:Pelp1	UTSW	11	70395434	missense	probably benign	0.03
R7694:Pelp1	UTSW	11	70394759	missense	probably damaging	0.99
R7873:Pelp1	UTSW	11	70394726	missense	probably damaging	1.00
R8478:Pelp1	UTSW	11	70394320	missense	unknown
R8719:Pelp1	UTSW	11	70401963	missense	probably damaging	0.97
R8910:Pelp1	UTSW	11	70396635	missense	probably damaging	0.96
R8918:Pelp1	UTSW	11	70405679	missense	probably damaging	0.98
R9632:Pelp1	UTSW	11	70394009	missense	unknown
V7581:Pelp1	UTSW	11	70398150	missense	probably damaging	0.99
V7582:Pelp1	UTSW	11	70398150	missense	probably damaging	0.99
V7583:Pelp1	UTSW	11	70398150	missense	probably damaging	0.99
Z1088:Pelp1	UTSW	11	70396890	missense	probably damaging	1.00
Z1177:Pelp1	UTSW	11	70397094	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTTCTGAGTGGGAAAGCAGCATC -3'
(R):5'- TGGTCTGAGGCATCGTTTACAGC -3'

Sequencing Primer
(F):5'- accactgaacccctctcc -3'
(R):5'- ATTGCACAGCATTTGGACC -3'

Posted On

2013-09-04