Incidental Mutation 'R9139:Vmn2r6'
ID 694195
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Name vomeronasal 2, receptor 6
Synonyms EG620718, EG667069
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R9139 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 64537561-64565298 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64556856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 186 (S186P)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
AlphaFold H3BK29
Predicted Effect probably benign
Transcript: ENSMUST00000165012
AA Change: S97P

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: S97P

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176481
AA Change: S186P

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: S186P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,281,546 V288A possibly damaging Het
Ankhd1 T A 18: 36,578,757 S135R Het
Axl G A 7: 25,761,421 T721I probably damaging Het
Blnk G A 19: 40,934,518 A388V probably benign Het
C8b T C 4: 104,784,434 V189A probably damaging Het
Ccdc33 G C 9: 58,076,559 I452M probably benign Het
Cfap57 T C 4: 118,554,851 T1199A probably benign Het
Chga G A 12: 102,561,885 V212M probably benign Het
Cspp1 T A 1: 10,116,650 M887K probably damaging Het
Cyp3a16 G C 5: 145,469,624 A6G unknown Het
Cyp4f17 G T 17: 32,524,894 E349* probably null Het
Dnajc13 A T 9: 104,207,840 D791E probably benign Het
Dpysl5 T C 5: 30,778,053 Y167H probably benign Het
Dqx1 G T 6: 83,059,778 Q254H possibly damaging Het
Eef1g A G 19: 8,978,019 T411A probably benign Het
Fancl C A 11: 26,387,231 A6E probably benign Het
Gabrr3 A G 16: 59,407,467 Q29R probably benign Het
Gtf2h2 A C 13: 100,481,270 L168R probably damaging Het
Hacl1 T A 14: 31,616,381 Q413L probably benign Het
Hdc A T 2: 126,597,917 V372E probably damaging Het
Hr A T 14: 70,557,639 H208L possibly damaging Het
Htr6 T C 4: 139,062,190 R255G possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kank2 A G 9: 21,770,074 V747A probably damaging Het
Kif5c A G 2: 49,730,279 T508A probably benign Het
Klhdc8b A G 9: 108,449,728 V145A probably damaging Het
Klk1b21 T A 7: 44,105,500 V73D probably damaging Het
Ksr1 T A 11: 79,020,746 M737L probably benign Het
Macf1 T C 4: 123,434,771 Y4723C probably damaging Het
Mcm7 T C 5: 138,169,135 Y182C probably damaging Het
Mtf2 T C 5: 108,104,532 probably null Het
Nrxn2 A T 19: 6,448,269 T255S probably benign Het
Olfr1154 A T 2: 87,902,764 M304K probably benign Het
Olfr1418 A G 19: 11,855,302 L217P probably damaging Het
Olfr248 A T 1: 174,391,083 T5S probably damaging Het
Olfr30 T A 11: 58,455,173 T259S possibly damaging Het
Olfr552 T A 7: 102,604,978 I208N probably damaging Het
Olfr741 T C 14: 50,486,250 L264P probably damaging Het
Pamr1 T A 2: 102,634,421 V305E probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg10 C T 6: 4,757,128 T568M unknown Het
Polr3a A G 14: 24,469,348 F664S probably damaging Het
Prb1 T A 6: 132,208,343 N109I unknown Het
Prdm2 T C 4: 143,132,182 I1513V probably benign Het
Prkd3 A C 17: 78,962,540 V564G possibly damaging Het
Prss16 A G 13: 22,008,343 S151P probably damaging Het
Rnf150 C T 8: 82,863,959 probably benign Het
Rttn A G 18: 89,020,137 T786A probably benign Het
Scin A G 12: 40,063,237 V645A possibly damaging Het
Slc25a20 T A 9: 108,680,199 M177K probably benign Het
Slc2a6 G A 2: 27,024,322 S261L possibly damaging Het
Slc4a7 A T 14: 14,796,115 D1118V probably damaging Het
Slc7a2 T C 8: 40,905,672 W351R probably damaging Het
Sp8 G A 12: 118,848,439 G10S probably damaging Het
St8sia2 A G 7: 73,966,765 I175T probably damaging Het
Tas2r122 T A 6: 132,711,816 N38I probably benign Het
Trim31 C T 17: 36,898,490 T46M possibly damaging Het
Trim31 A G 17: 36,909,253 K354E probably benign Het
Trio G A 15: 27,749,836 Q2260* probably null Het
Trpm1 T C 7: 64,199,195 I63T probably benign Het
Ugt2b37 T C 5: 87,251,777 K291E probably benign Het
Usp54 T C 14: 20,577,094 T499A probably benign Het
Vmn1r35 T C 6: 66,678,949 I246V probably benign Het
Vmn2r76 T A 7: 86,229,962 M377L probably benign Het
Zeb2 A C 2: 44,988,625 M1243R possibly damaging Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64556774 missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64539951 nonsense probably null
R7562:Vmn2r6 UTSW 3 64556520 missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64565262 missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64565142 missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64556570 missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64538022 missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64559820 missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64559824 missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64547643 intron probably benign
R8169:Vmn2r6 UTSW 3 64539889 missense probably benign 0.01
R8337:Vmn2r6 UTSW 3 64556105 nonsense probably null
R8736:Vmn2r6 UTSW 3 64559800 missense probably damaging 1.00
R8962:Vmn2r6 UTSW 3 64556155 missense probably damaging 1.00
R9206:Vmn2r6 UTSW 3 64559611 missense probably damaging 0.97
R9295:Vmn2r6 UTSW 3 64556063 missense probably benign 0.00
R9332:Vmn2r6 UTSW 3 64547250 missense probably benign 0.01
R9616:Vmn2r6 UTSW 3 64538303 missense probably damaging 1.00
R9663:Vmn2r6 UTSW 3 64556128 missense not run
R9685:Vmn2r6 UTSW 3 64556660 missense not run
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64556325 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACAAAGGTTGGCCCTCTC -3'
(R):5'- TGTCAAAATTGTCCCCATCTACACC -3'

Sequencing Primer
(F):5'- AAAGGTTGGCCCTCTCCATTTC -3'
(R):5'- TTGTCCCCATCTACACCCAGAAAG -3'
Posted On 2022-01-20