Mutagenetix > Incidental Mutation

Incidental Mutation 'R9139:Trpm1'

694214

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9139 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64199195 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 63 (I63T)

Ref Sequence

ENSEMBL: ENSMUSP00000082318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205690] [ENSMUST00000205731] [ENSMUST00000206049] [ENSMUST00000206107] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: I63T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: I63T

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000177102

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348
AA Change: I63T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

probably benign
Transcript: ENSMUST00000205684

Predicted Effect

probably benign
Transcript: ENSMUST00000205690

Predicted Effect

probably benign
Transcript: ENSMUST00000205731

Predicted Effect

probably benign
Transcript: ENSMUST00000206049

Predicted Effect

probably benign
Transcript: ENSMUST00000206107

Predicted Effect

probably benign
Transcript: ENSMUST00000206263

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: I63T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206314
AA Change: I63T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000206706

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	G	1: 74,281,546	V288A	possibly damaging	Het
Ankhd1	T	A	18: 36,578,757	S135R		Het
Axl	G	A	7: 25,761,421	T721I	probably damaging	Het
Blnk	G	A	19: 40,934,518	A388V	probably benign	Het
C8b	T	C	4: 104,784,434	V189A	probably damaging	Het
Ccdc33	G	C	9: 58,076,559	I452M	probably benign	Het
Cfap57	T	C	4: 118,554,851	T1199A	probably benign	Het
Chga	G	A	12: 102,561,885	V212M	probably benign	Het
Cspp1	T	A	1: 10,116,650	M887K	probably damaging	Het
Cyp3a16	G	C	5: 145,469,624	A6G	unknown	Het
Cyp4f17	G	T	17: 32,524,894	E349*	probably null	Het
Dnajc13	A	T	9: 104,207,840	D791E	probably benign	Het
Dpysl5	T	C	5: 30,778,053	Y167H	probably benign	Het
Dqx1	G	T	6: 83,059,778	Q254H	possibly damaging	Het
Eef1g	A	G	19: 8,978,019	T411A	probably benign	Het
Fancl	C	A	11: 26,387,231	A6E	probably benign	Het
Gabrr3	A	G	16: 59,407,467	Q29R	probably benign	Het
Gtf2h2	A	C	13: 100,481,270	L168R	probably damaging	Het
Hacl1	T	A	14: 31,616,381	Q413L	probably benign	Het
Hdc	A	T	2: 126,597,917	V372E	probably damaging	Het
Hr	A	T	14: 70,557,639	H208L	possibly damaging	Het
Htr6	T	C	4: 139,062,190	R255G	possibly damaging	Het
Jup	C	T	11: 100,379,565	C372Y	probably damaging	Het
Kank2	A	G	9: 21,770,074	V747A	probably damaging	Het
Kif5c	A	G	2: 49,730,279	T508A	probably benign	Het
Klhdc8b	A	G	9: 108,449,728	V145A	probably damaging	Het
Klk1b21	T	A	7: 44,105,500	V73D	probably damaging	Het
Ksr1	T	A	11: 79,020,746	M737L	probably benign	Het
Macf1	T	C	4: 123,434,771	Y4723C	probably damaging	Het
Mcm7	T	C	5: 138,169,135	Y182C	probably damaging	Het
Mtf2	T	C	5: 108,104,532		probably null	Het
Nrxn2	A	T	19: 6,448,269	T255S	probably benign	Het
Olfr1154	A	T	2: 87,902,764	M304K	probably benign	Het
Olfr1418	A	G	19: 11,855,302	L217P	probably damaging	Het
Olfr248	A	T	1: 174,391,083	T5S	probably damaging	Het
Olfr30	T	A	11: 58,455,173	T259S	possibly damaging	Het
Olfr552	T	A	7: 102,604,978	I208N	probably damaging	Het
Olfr741	T	C	14: 50,486,250	L264P	probably damaging	Het
Pamr1	T	A	2: 102,634,421	V305E	probably benign	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Peg10	C	T	6: 4,757,128	T568M	unknown	Het
Polr3a	A	G	14: 24,469,348	F664S	probably damaging	Het
Prb1	T	A	6: 132,208,343	N109I	unknown	Het
Prdm2	T	C	4: 143,132,182	I1513V	probably benign	Het
Prkd3	A	C	17: 78,962,540	V564G	possibly damaging	Het
Prss16	A	G	13: 22,008,343	S151P	probably damaging	Het
Rnf150	C	T	8: 82,863,959		probably benign	Het
Rttn	A	G	18: 89,020,137	T786A	probably benign	Het
Scin	A	G	12: 40,063,237	V645A	possibly damaging	Het
Slc25a20	T	A	9: 108,680,199	M177K	probably benign	Het
Slc2a6	G	A	2: 27,024,322	S261L	possibly damaging	Het
Slc4a7	A	T	14: 14,796,115	D1118V	probably damaging	Het
Slc7a2	T	C	8: 40,905,672	W351R	probably damaging	Het
Sp8	G	A	12: 118,848,439	G10S	probably damaging	Het
St8sia2	A	G	7: 73,966,765	I175T	probably damaging	Het
Tas2r122	T	A	6: 132,711,816	N38I	probably benign	Het
Trim31	C	T	17: 36,898,490	T46M	possibly damaging	Het
Trim31	A	G	17: 36,909,253	K354E	probably benign	Het
Trio	G	A	15: 27,749,836	Q2260*	probably null	Het
Ugt2b37	T	C	5: 87,251,777	K291E	probably benign	Het
Usp54	T	C	14: 20,577,094	T499A	probably benign	Het
Vmn1r35	T	C	6: 66,678,949	I246V	probably benign	Het
Vmn2r6	A	G	3: 64,556,856	S186P	probably benign	Het
Vmn2r76	T	A	7: 86,229,962	M377L	probably benign	Het
Zeb2	A	C	2: 44,988,625	M1243R	possibly damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AAATGGGCATTTCAGGGGACAC -3'
(R):5'- AAGGCTAAGTTGCTTTGTACAGC -3'

Sequencing Primer
(F):5'- GACACCTCTGTCCCTGATAAAGCTG -3'
(R):5'- GCTTTGTACAGCACCCCATCAC -3'

Posted On

2022-01-20