Incidental Mutation 'R9139:St8sia2'
ID 694215
Institutional Source Beutler Lab
Gene Symbol St8sia2
Ensembl Gene ENSMUSG00000025789
Gene Name ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Synonyms Siat8b, ST8SiaII
Accession Numbers

Ncbi RefSeq: NM_009181.2; MGI:106020

Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R9139 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 73939119-74013690 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73966765 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 175 (I175T)
Ref Sequence ENSEMBL: ENSMUSP00000026896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026896] [ENSMUST00000191970]
AlphaFold O35696
Predicted Effect probably damaging
Transcript: ENSMUST00000026896
AA Change: I175T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026896
Gene: ENSMUSG00000025789
AA Change: I175T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glyco_transf_29 109 369 2.7e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191970
AA Change: I154T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141307
Gene: ENSMUSG00000025789
AA Change: I154T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
Pfam:Glyco_transf_29 84 206 5.8e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype Strain: 3051219
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that is thought to catalyze the transfer of sialic acid from CMP-sialic acid to N-linked oligosaccharides and glycoproteins. The encoded protein may be found in the Golgi apparatus and may be involved in the production of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). This protein is a member of glycosyltransferase family 29. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal mossy fiber morphology, increased exploration in new environment and impaired fear responses. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,281,546 V288A possibly damaging Het
Ankhd1 T A 18: 36,578,757 S135R Het
Axl G A 7: 25,761,421 T721I probably damaging Het
Blnk G A 19: 40,934,518 A388V probably benign Het
C8b T C 4: 104,784,434 V189A probably damaging Het
Ccdc33 G C 9: 58,076,559 I452M probably benign Het
Cfap57 T C 4: 118,554,851 T1199A probably benign Het
Chga G A 12: 102,561,885 V212M probably benign Het
Cspp1 T A 1: 10,116,650 M887K probably damaging Het
Cyp3a16 G C 5: 145,469,624 A6G unknown Het
Cyp4f17 G T 17: 32,524,894 E349* probably null Het
Dnajc13 A T 9: 104,207,840 D791E probably benign Het
Dpysl5 T C 5: 30,778,053 Y167H probably benign Het
Dqx1 G T 6: 83,059,778 Q254H possibly damaging Het
Eef1g A G 19: 8,978,019 T411A probably benign Het
Fancl C A 11: 26,387,231 A6E probably benign Het
Gabrr3 A G 16: 59,407,467 Q29R probably benign Het
Gtf2h2 A C 13: 100,481,270 L168R probably damaging Het
Hacl1 T A 14: 31,616,381 Q413L probably benign Het
Hdc A T 2: 126,597,917 V372E probably damaging Het
Hr A T 14: 70,557,639 H208L possibly damaging Het
Htr6 T C 4: 139,062,190 R255G possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kank2 A G 9: 21,770,074 V747A probably damaging Het
Kif5c A G 2: 49,730,279 T508A probably benign Het
Klhdc8b A G 9: 108,449,728 V145A probably damaging Het
Klk1b21 T A 7: 44,105,500 V73D probably damaging Het
Ksr1 T A 11: 79,020,746 M737L probably benign Het
Macf1 T C 4: 123,434,771 Y4723C probably damaging Het
Mcm7 T C 5: 138,169,135 Y182C probably damaging Het
Mtf2 T C 5: 108,104,532 probably null Het
Nrxn2 A T 19: 6,448,269 T255S probably benign Het
Olfr1154 A T 2: 87,902,764 M304K probably benign Het
Olfr1418 A G 19: 11,855,302 L217P probably damaging Het
Olfr248 A T 1: 174,391,083 T5S probably damaging Het
Olfr30 T A 11: 58,455,173 T259S possibly damaging Het
Olfr552 T A 7: 102,604,978 I208N probably damaging Het
Olfr741 T C 14: 50,486,250 L264P probably damaging Het
Pamr1 T A 2: 102,634,421 V305E probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg10 C T 6: 4,757,128 T568M unknown Het
Polr3a A G 14: 24,469,348 F664S probably damaging Het
Prb1 T A 6: 132,208,343 N109I unknown Het
Prdm2 T C 4: 143,132,182 I1513V probably benign Het
Prkd3 A C 17: 78,962,540 V564G possibly damaging Het
Prss16 A G 13: 22,008,343 S151P probably damaging Het
Rnf150 C T 8: 82,863,959 probably benign Het
Rttn A G 18: 89,020,137 T786A probably benign Het
Scin A G 12: 40,063,237 V645A possibly damaging Het
Slc25a20 T A 9: 108,680,199 M177K probably benign Het
Slc2a6 G A 2: 27,024,322 S261L possibly damaging Het
Slc4a7 A T 14: 14,796,115 D1118V probably damaging Het
Slc7a2 T C 8: 40,905,672 W351R probably damaging Het
Sp8 G A 12: 118,848,439 G10S probably damaging Het
Tas2r122 T A 6: 132,711,816 N38I probably benign Het
Trim31 C T 17: 36,898,490 T46M possibly damaging Het
Trim31 A G 17: 36,909,253 K354E probably benign Het
Trio G A 15: 27,749,836 Q2260* probably null Het
Trpm1 T C 7: 64,199,195 I63T probably benign Het
Ugt2b37 T C 5: 87,251,777 K291E probably benign Het
Usp54 T C 14: 20,577,094 T499A probably benign Het
Vmn1r35 T C 6: 66,678,949 I246V probably benign Het
Vmn2r6 A G 3: 64,556,856 S186P probably benign Het
Vmn2r76 T A 7: 86,229,962 M377L probably benign Het
Zeb2 A C 2: 44,988,625 M1243R possibly damaging Het
Other mutations in St8sia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02161:St8sia2 APN 7 73976682 missense probably benign 0.00
IGL02261:St8sia2 APN 7 73966846 missense probably damaging 1.00
IGL02941:St8sia2 APN 7 73976649 intron probably benign
IGL02971:St8sia2 APN 7 73966811 missense probably damaging 1.00
BB001:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
BB011:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
IGL03147:St8sia2 UTSW 7 73966819 missense probably damaging 1.00
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73971952 missense probably damaging 1.00
R0733:St8sia2 UTSW 7 73960840 missense probably benign
R1202:St8sia2 UTSW 7 73972035 missense probably benign 0.43
R1419:St8sia2 UTSW 7 73966994 nonsense probably null
R1962:St8sia2 UTSW 7 73943309 missense probably damaging 1.00
R2051:St8sia2 UTSW 7 73943202 missense possibly damaging 0.91
R4106:St8sia2 UTSW 7 73960761 missense probably damaging 1.00
R4989:St8sia2 UTSW 7 73966961 missense possibly damaging 0.75
R5541:St8sia2 UTSW 7 73966900 missense probably benign 0.00
R5859:St8sia2 UTSW 7 73966906 missense probably damaging 1.00
R6029:St8sia2 UTSW 7 73960710 missense possibly damaging 0.96
R6260:St8sia2 UTSW 7 73976693 missense possibly damaging 0.56
R6416:St8sia2 UTSW 7 73971921 missense probably damaging 1.00
R7371:St8sia2 UTSW 7 73966927 missense probably damaging 0.99
R7424:St8sia2 UTSW 7 73960902 missense possibly damaging 0.66
R7763:St8sia2 UTSW 7 73943321 missense probably damaging 1.00
R7924:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
R8688:St8sia2 UTSW 7 73943344 missense probably damaging 1.00
R9137:St8sia2 UTSW 7 73960906 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACATTGTGATTGGAGACATGATTCCC -3'
(R):5'- CCCTGAAGCCTGGAGACATTATTC -3'

Sequencing Primer
(F):5'- ATTGGATTTGGGCACACACC -3'
(R):5'- CATTATATCTTTGATCGAGACAGCAC -3'
Posted On 2022-01-20