Incidental Mutation 'R9139:Or52k2'
ID 694217
Institutional Source Beutler Lab
Gene Symbol Or52k2
Ensembl Gene ENSMUSG00000073973
Gene Name olfactory receptor family 52 subfamily K member 2
Synonyms GA_x6K02T2PBJ9-5323062-5324015, Olfr552, MOR28-1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R9139 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102253563-102254516 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102254185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 208 (I208N)
Ref Sequence ENSEMBL: ENSMUSP00000150317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098223] [ENSMUST00000215712]
AlphaFold E9Q545
Predicted Effect probably damaging
Transcript: ENSMUST00000098223
AA Change: I208N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095826
Gene: ENSMUSG00000073973
AA Change: I208N

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 6e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 270 4.4e-8 PFAM
Pfam:7tm_1 43 294 9.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215712
AA Change: I208N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,320,705 (GRCm39) V288A possibly damaging Het
Ankhd1 T A 18: 36,711,810 (GRCm39) S135R Het
Axl G A 7: 25,460,846 (GRCm39) T721I probably damaging Het
Blnk G A 19: 40,922,962 (GRCm39) A388V probably benign Het
C8b T C 4: 104,641,631 (GRCm39) V189A probably damaging Het
Ccdc33 G C 9: 57,983,842 (GRCm39) I452M probably benign Het
Cfap57 T C 4: 118,412,048 (GRCm39) T1199A probably benign Het
Chga G A 12: 102,528,144 (GRCm39) V212M probably benign Het
Cspp1 T A 1: 10,186,875 (GRCm39) M887K probably damaging Het
Cyp3a16 G C 5: 145,406,434 (GRCm39) A6G unknown Het
Cyp4f17 G T 17: 32,743,868 (GRCm39) E349* probably null Het
Dnajc13 A T 9: 104,085,039 (GRCm39) D791E probably benign Het
Dpysl5 T C 5: 30,935,397 (GRCm39) Y167H probably benign Het
Dqx1 G T 6: 83,036,759 (GRCm39) Q254H possibly damaging Het
Eef1g A G 19: 8,955,383 (GRCm39) T411A probably benign Het
Fancl C A 11: 26,337,231 (GRCm39) A6E probably benign Het
Gabrr3 A G 16: 59,227,830 (GRCm39) Q29R probably benign Het
Gtf2h2 A C 13: 100,617,778 (GRCm39) L168R probably damaging Het
Hacl1 T A 14: 31,338,338 (GRCm39) Q413L probably benign Het
Hdc A T 2: 126,439,837 (GRCm39) V372E probably damaging Het
Hr A T 14: 70,795,079 (GRCm39) H208L possibly damaging Het
Htr6 T C 4: 138,789,501 (GRCm39) R255G possibly damaging Het
Jup C T 11: 100,270,391 (GRCm39) C372Y probably damaging Het
Kank2 A G 9: 21,681,370 (GRCm39) V747A probably damaging Het
Kif5c A G 2: 49,620,291 (GRCm39) T508A probably benign Het
Klhdc8b A G 9: 108,326,927 (GRCm39) V145A probably damaging Het
Klk1b21 T A 7: 43,754,924 (GRCm39) V73D probably damaging Het
Ksr1 T A 11: 78,911,572 (GRCm39) M737L probably benign Het
Macf1 T C 4: 123,328,564 (GRCm39) Y4723C probably damaging Het
Mcm7 T C 5: 138,167,397 (GRCm39) Y182C probably damaging Het
Mtf2 T C 5: 108,252,398 (GRCm39) probably null Het
Nrxn2 A T 19: 6,498,299 (GRCm39) T255S probably benign Het
Or10v9 A G 19: 11,832,666 (GRCm39) L217P probably damaging Het
Or10x4 A T 1: 174,218,649 (GRCm39) T5S probably damaging Het
Or11g25 T C 14: 50,723,707 (GRCm39) L264P probably damaging Het
Or2z2 T A 11: 58,345,999 (GRCm39) T259S possibly damaging Het
Or9m1 A T 2: 87,733,108 (GRCm39) M304K probably benign Het
Pamr1 T A 2: 102,464,766 (GRCm39) V305E probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Peg10 C T 6: 4,757,128 (GRCm39) T568M unknown Het
Polr3a A G 14: 24,519,416 (GRCm39) F664S probably damaging Het
Prb1a T A 6: 132,185,306 (GRCm39) N109I unknown Het
Prdm2 T C 4: 142,858,752 (GRCm39) I1513V probably benign Het
Prkd3 A C 17: 79,269,969 (GRCm39) V564G possibly damaging Het
Prss16 A G 13: 22,192,513 (GRCm39) S151P probably damaging Het
Rnf150 C T 8: 83,590,588 (GRCm39) probably benign Het
Rttn A G 18: 89,038,261 (GRCm39) T786A probably benign Het
Scin A G 12: 40,113,236 (GRCm39) V645A possibly damaging Het
Slc25a20 T A 9: 108,557,398 (GRCm39) M177K probably benign Het
Slc2a6 G A 2: 26,914,334 (GRCm39) S261L possibly damaging Het
Slc4a7 A T 14: 14,796,115 (GRCm38) D1118V probably damaging Het
Slc7a2 T C 8: 41,358,709 (GRCm39) W351R probably damaging Het
Sp8 G A 12: 118,812,174 (GRCm39) G10S probably damaging Het
St8sia2 A G 7: 73,616,513 (GRCm39) I175T probably damaging Het
Tas2r122 T A 6: 132,688,779 (GRCm39) N38I probably benign Het
Trim31 C T 17: 37,209,382 (GRCm39) T46M possibly damaging Het
Trim31 A G 17: 37,220,145 (GRCm39) K354E probably benign Het
Trio G A 15: 27,749,922 (GRCm39) Q2260* probably null Het
Trpm1 T C 7: 63,848,943 (GRCm39) I63T probably benign Het
Ugt2b37 T C 5: 87,399,636 (GRCm39) K291E probably benign Het
Usp54 T C 14: 20,627,162 (GRCm39) T499A probably benign Het
Vmn1r35 T C 6: 66,655,933 (GRCm39) I246V probably benign Het
Vmn2r6 A G 3: 64,464,277 (GRCm39) S186P probably benign Het
Vmn2r76 T A 7: 85,879,170 (GRCm39) M377L probably benign Het
Zeb2 A C 2: 44,878,637 (GRCm39) M1243R possibly damaging Het
Other mutations in Or52k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Or52k2 APN 7 102,253,564 (GRCm39) start codon destroyed probably null 0.99
IGL03061:Or52k2 APN 7 102,253,946 (GRCm39) missense probably damaging 0.99
R0989:Or52k2 UTSW 7 102,253,690 (GRCm39) missense probably damaging 1.00
R1513:Or52k2 UTSW 7 102,254,509 (GRCm39) missense probably benign 0.09
R1969:Or52k2 UTSW 7 102,253,777 (GRCm39) missense probably damaging 0.99
R3177:Or52k2 UTSW 7 102,253,783 (GRCm39) missense possibly damaging 0.94
R3277:Or52k2 UTSW 7 102,253,783 (GRCm39) missense possibly damaging 0.94
R4019:Or52k2 UTSW 7 102,253,849 (GRCm39) missense probably damaging 1.00
R4028:Or52k2 UTSW 7 102,254,500 (GRCm39) missense possibly damaging 0.62
R5216:Or52k2 UTSW 7 102,254,028 (GRCm39) missense probably benign 0.00
R5444:Or52k2 UTSW 7 102,254,076 (GRCm39) nonsense probably null
R5461:Or52k2 UTSW 7 102,253,615 (GRCm39) missense probably damaging 0.99
R7706:Or52k2 UTSW 7 102,253,853 (GRCm39) missense probably benign 0.12
R8348:Or52k2 UTSW 7 102,254,207 (GRCm39) missense probably benign 0.01
R8448:Or52k2 UTSW 7 102,254,207 (GRCm39) missense probably benign 0.01
R8919:Or52k2 UTSW 7 102,253,711 (GRCm39) missense probably damaging 1.00
R8933:Or52k2 UTSW 7 102,253,637 (GRCm39) missense probably damaging 1.00
R9009:Or52k2 UTSW 7 102,253,642 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTCGATCGTTATGTTGC -3'
(R):5'- CACGATGCATGACTGAGGAG -3'

Sequencing Primer
(F):5'- ATCATCAAGATTGGCCTGGC -3'
(R):5'- TGCATGACTGAGGAGATGACTAC -3'
Posted On 2022-01-20