Incidental Mutation 'R9139:Olfr552'
ID 694217
Institutional Source Beutler Lab
Gene Symbol Olfr552
Ensembl Gene ENSMUSG00000073973
Gene Name olfactory receptor 552
Synonyms GA_x6K02T2PBJ9-5323062-5324015, MOR28-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R9139 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102597770-102608125 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102604978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 208 (I208N)
Ref Sequence ENSEMBL: ENSMUSP00000150317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098223] [ENSMUST00000215712]
AlphaFold E9Q545
Predicted Effect probably damaging
Transcript: ENSMUST00000098223
AA Change: I208N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095826
Gene: ENSMUSG00000073973
AA Change: I208N

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 6e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 270 4.4e-8 PFAM
Pfam:7tm_1 43 294 9.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215712
AA Change: I208N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,281,546 V288A possibly damaging Het
Ankhd1 T A 18: 36,578,757 S135R Het
Axl G A 7: 25,761,421 T721I probably damaging Het
Blnk G A 19: 40,934,518 A388V probably benign Het
C8b T C 4: 104,784,434 V189A probably damaging Het
Ccdc33 G C 9: 58,076,559 I452M probably benign Het
Cfap57 T C 4: 118,554,851 T1199A probably benign Het
Chga G A 12: 102,561,885 V212M probably benign Het
Cspp1 T A 1: 10,116,650 M887K probably damaging Het
Cyp3a16 G C 5: 145,469,624 A6G unknown Het
Cyp4f17 G T 17: 32,524,894 E349* probably null Het
Dnajc13 A T 9: 104,207,840 D791E probably benign Het
Dpysl5 T C 5: 30,778,053 Y167H probably benign Het
Dqx1 G T 6: 83,059,778 Q254H possibly damaging Het
Eef1g A G 19: 8,978,019 T411A probably benign Het
Fancl C A 11: 26,387,231 A6E probably benign Het
Gabrr3 A G 16: 59,407,467 Q29R probably benign Het
Gtf2h2 A C 13: 100,481,270 L168R probably damaging Het
Hacl1 T A 14: 31,616,381 Q413L probably benign Het
Hdc A T 2: 126,597,917 V372E probably damaging Het
Hr A T 14: 70,557,639 H208L possibly damaging Het
Htr6 T C 4: 139,062,190 R255G possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kank2 A G 9: 21,770,074 V747A probably damaging Het
Kif5c A G 2: 49,730,279 T508A probably benign Het
Klhdc8b A G 9: 108,449,728 V145A probably damaging Het
Klk1b21 T A 7: 44,105,500 V73D probably damaging Het
Ksr1 T A 11: 79,020,746 M737L probably benign Het
Macf1 T C 4: 123,434,771 Y4723C probably damaging Het
Mcm7 T C 5: 138,169,135 Y182C probably damaging Het
Mtf2 T C 5: 108,104,532 probably null Het
Nrxn2 A T 19: 6,448,269 T255S probably benign Het
Olfr1154 A T 2: 87,902,764 M304K probably benign Het
Olfr1418 A G 19: 11,855,302 L217P probably damaging Het
Olfr248 A T 1: 174,391,083 T5S probably damaging Het
Olfr30 T A 11: 58,455,173 T259S possibly damaging Het
Olfr741 T C 14: 50,486,250 L264P probably damaging Het
Pamr1 T A 2: 102,634,421 V305E probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg10 C T 6: 4,757,128 T568M unknown Het
Polr3a A G 14: 24,469,348 F664S probably damaging Het
Prb1 T A 6: 132,208,343 N109I unknown Het
Prdm2 T C 4: 143,132,182 I1513V probably benign Het
Prkd3 A C 17: 78,962,540 V564G possibly damaging Het
Prss16 A G 13: 22,008,343 S151P probably damaging Het
Rnf150 C T 8: 82,863,959 probably benign Het
Rttn A G 18: 89,020,137 T786A probably benign Het
Scin A G 12: 40,063,237 V645A possibly damaging Het
Slc25a20 T A 9: 108,680,199 M177K probably benign Het
Slc2a6 G A 2: 27,024,322 S261L possibly damaging Het
Slc4a7 A T 14: 14,796,115 D1118V probably damaging Het
Slc7a2 T C 8: 40,905,672 W351R probably damaging Het
Sp8 G A 12: 118,848,439 G10S probably damaging Het
St8sia2 A G 7: 73,966,765 I175T probably damaging Het
Tas2r122 T A 6: 132,711,816 N38I probably benign Het
Trim31 C T 17: 36,898,490 T46M possibly damaging Het
Trim31 A G 17: 36,909,253 K354E probably benign Het
Trio G A 15: 27,749,836 Q2260* probably null Het
Trpm1 T C 7: 64,199,195 I63T probably benign Het
Ugt2b37 T C 5: 87,251,777 K291E probably benign Het
Usp54 T C 14: 20,577,094 T499A probably benign Het
Vmn1r35 T C 6: 66,678,949 I246V probably benign Het
Vmn2r6 A G 3: 64,556,856 S186P probably benign Het
Vmn2r76 T A 7: 86,229,962 M377L probably benign Het
Zeb2 A C 2: 44,988,625 M1243R possibly damaging Het
Other mutations in Olfr552
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr552 APN 7 102604357 start codon destroyed probably null 0.99
IGL03061:Olfr552 APN 7 102604739 missense probably damaging 0.99
R0989:Olfr552 UTSW 7 102604483 missense probably damaging 1.00
R1513:Olfr552 UTSW 7 102605302 missense probably benign 0.09
R1969:Olfr552 UTSW 7 102604570 missense probably damaging 0.99
R3177:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R3277:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R4019:Olfr552 UTSW 7 102604642 missense probably damaging 1.00
R4028:Olfr552 UTSW 7 102605293 missense possibly damaging 0.62
R5216:Olfr552 UTSW 7 102604821 missense probably benign 0.00
R5444:Olfr552 UTSW 7 102604869 nonsense probably null
R5461:Olfr552 UTSW 7 102604408 missense probably damaging 0.99
R7706:Olfr552 UTSW 7 102604646 missense probably benign 0.12
R8348:Olfr552 UTSW 7 102605000 missense probably benign 0.01
R8448:Olfr552 UTSW 7 102605000 missense probably benign 0.01
R8919:Olfr552 UTSW 7 102604504 missense probably damaging 1.00
R8933:Olfr552 UTSW 7 102604430 missense probably damaging 1.00
R9009:Olfr552 UTSW 7 102604435 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTCGATCGTTATGTTGC -3'
(R):5'- CACGATGCATGACTGAGGAG -3'

Sequencing Primer
(F):5'- ATCATCAAGATTGGCCTGGC -3'
(R):5'- TGCATGACTGAGGAGATGACTAC -3'
Posted On 2022-01-20