Incidental Mutation 'V7580:Tnrc6c'
ID 69423
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Name trinucleotide repeat containing 6C
Synonyms 9930033H14Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # V7580 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 117545115-117654265 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 117614152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 770 (R770H)
Ref Sequence ENSEMBL: ENSMUSP00000115221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026658
AA Change: R930H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: R930H

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106344
AA Change: R930H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: R930H

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138299
AA Change: R770H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571
AA Change: R770H

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141115
Meta Mutation Damage Score 0.3737 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,849,914 (GRCm39) M950L probably benign Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 (GRCm39) H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 18,025,526 (GRCm39) probably null Het
Cfi T A 3: 129,648,641 (GRCm39) I175K possibly damaging Het
D630003M21Rik T C 2: 158,042,931 (GRCm39) T870A probably benign Het
Dnah12 T A 14: 26,495,050 (GRCm39) N1369K possibly damaging Het
Dnajc22 T A 15: 98,999,363 (GRCm39) Y183N probably damaging Het
Erv3 T C 2: 131,697,846 (GRCm39) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Gm10770 T A 2: 150,021,404 (GRCm39) K38* probably null Het
Gm4787 G A 12: 81,424,341 (GRCm39) Q606* probably null Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Klc1 A T 12: 111,741,006 (GRCm39) I161F probably benign Het
Lpar5 C A 6: 125,058,690 (GRCm39) A137E possibly damaging Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Lrrc37a T G 11: 103,346,338 (GRCm39) N3176T possibly damaging Het
Med20 G A 17: 47,929,757 (GRCm39) V65M probably damaging Het
Mylk G T 16: 34,815,574 (GRCm39) probably null Het
Numbl T C 7: 26,979,027 (GRCm39) S379P probably benign Het
Or10j7 G T 1: 173,011,531 (GRCm39) L157I probably benign Het
Or5an6 G A 19: 12,371,914 (GRCm39) V96I probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Papln C T 12: 83,825,608 (GRCm39) R608C possibly damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pigx T C 16: 31,906,240 (GRCm39) D129G probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Plekhb1 T C 7: 100,303,825 (GRCm39) T112A probably benign Het
Ppwd1 A G 13: 104,356,745 (GRCm39) Y257H probably damaging Het
Recql4 T C 15: 76,590,369 (GRCm39) D705G possibly damaging Het
Ror1 A G 4: 100,298,130 (GRCm39) Q501R probably damaging Het
Slc30a4 T A 2: 122,531,458 (GRCm39) M136L probably benign Het
Spaca1 T C 4: 34,039,311 (GRCm39) E192G probably damaging Het
Spata31 C A 13: 65,069,462 (GRCm39) P537T probably benign Het
Sptbn2 C T 19: 4,800,660 (GRCm39) R2292C probably damaging Het
Trps1 T C 15: 50,694,973 (GRCm39) K150E probably damaging Het
Tspyl3 A G 2: 153,066,980 (GRCm39) V86A probably benign Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zmynd8 G A 2: 165,654,314 (GRCm39) R724* probably null Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117,605,011 (GRCm39) missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117,612,855 (GRCm39) missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117,612,811 (GRCm39) missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117,605,083 (GRCm39) missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117,613,939 (GRCm39) missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117,640,161 (GRCm39) splice site probably benign
IGL01869:Tnrc6c APN 11 117,646,274 (GRCm39) missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117,612,025 (GRCm39) missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117,613,803 (GRCm39) missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117,633,826 (GRCm39) missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117,622,996 (GRCm39) missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117,640,651 (GRCm39) splice site probably benign
rodion UTSW 11 117,629,176 (GRCm39) critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117,614,152 (GRCm39) missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117,651,564 (GRCm39) missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117,612,284 (GRCm39) missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117,643,811 (GRCm39) missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117,630,707 (GRCm39) missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117,630,707 (GRCm39) missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117,651,375 (GRCm39) missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117,613,447 (GRCm39) missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117,612,748 (GRCm39) missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117,612,500 (GRCm39) missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117,624,529 (GRCm39) missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117,650,463 (GRCm39) missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117,648,867 (GRCm39) missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117,651,556 (GRCm39) missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117,605,188 (GRCm39) missense probably benign
R1901:Tnrc6c UTSW 11 117,613,831 (GRCm39) missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117,646,849 (GRCm39) missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117,646,849 (GRCm39) missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117,646,849 (GRCm39) missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117,646,849 (GRCm39) missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117,640,451 (GRCm39) missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117,613,950 (GRCm39) missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117,614,055 (GRCm39) missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117,646,309 (GRCm39) missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117,613,324 (GRCm39) missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117,633,784 (GRCm39) missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117,633,784 (GRCm39) missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117,611,797 (GRCm39) missense probably benign
R4765:Tnrc6c UTSW 11 117,633,753 (GRCm39) missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117,613,731 (GRCm39) missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117,611,872 (GRCm39) missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117,611,872 (GRCm39) missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117,629,176 (GRCm39) critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117,651,555 (GRCm39) missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117,651,555 (GRCm39) missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117,614,113 (GRCm39) missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117,649,731 (GRCm39) splice site silent
R5428:Tnrc6c UTSW 11 117,591,588 (GRCm39) start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117,651,669 (GRCm39) missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117,640,097 (GRCm39) nonsense probably null
R5875:Tnrc6c UTSW 11 117,650,534 (GRCm39) missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117,613,345 (GRCm39) missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117,626,831 (GRCm39) missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117,640,440 (GRCm39) missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117,613,567 (GRCm39) missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117,624,444 (GRCm39) missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117,612,800 (GRCm39) missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117,604,952 (GRCm39) missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117,614,354 (GRCm39) missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117,632,606 (GRCm39) missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117,612,780 (GRCm39) missense probably benign
R7515:Tnrc6c UTSW 11 117,632,507 (GRCm39) missense probably benign 0.03
R7665:Tnrc6c UTSW 11 117,611,777 (GRCm39) missense possibly damaging 0.46
R7755:Tnrc6c UTSW 11 117,648,912 (GRCm39) missense probably benign 0.00
R8679:Tnrc6c UTSW 11 117,604,961 (GRCm39) missense probably benign
R8824:Tnrc6c UTSW 11 117,630,680 (GRCm39) splice site probably benign
R8971:Tnrc6c UTSW 11 117,640,089 (GRCm39) missense possibly damaging 0.95
R9261:Tnrc6c UTSW 11 117,605,105 (GRCm39) missense probably damaging 0.99
R9283:Tnrc6c UTSW 11 117,591,630 (GRCm39) missense unknown
R9342:Tnrc6c UTSW 11 117,630,720 (GRCm39) missense probably benign 0.01
R9633:Tnrc6c UTSW 11 117,638,009 (GRCm39) missense probably damaging 1.00
R9761:Tnrc6c UTSW 11 117,623,136 (GRCm39) missense probably benign
V7581:Tnrc6c UTSW 11 117,614,152 (GRCm39) missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117,614,152 (GRCm39) missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117,614,152 (GRCm39) missense probably damaging 1.00
Z1176:Tnrc6c UTSW 11 117,623,003 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGTTGGAATGATGCCACGAGATG -3'
(R):5'- TCCAAGAATTTACACAGGCACGGAG -3'

Sequencing Primer
(F):5'- GAGTCTCTCAAGCCTGGTC -3'
(R):5'- AGCAGTGGTGACCGATTC -3'
Posted On 2013-09-04