Incidental Mutation 'R9139:Polr3a'
ID 694236
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC1, 9330175N20Rik, RPC155
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9139 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 24448696-24487058 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24469348 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 664 (F664S)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: F664S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: F664S

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,281,546 V288A possibly damaging Het
Ankhd1 T A 18: 36,578,757 S135R Het
Axl G A 7: 25,761,421 T721I probably damaging Het
Blnk G A 19: 40,934,518 A388V probably benign Het
C8b T C 4: 104,784,434 V189A probably damaging Het
Ccdc33 G C 9: 58,076,559 I452M probably benign Het
Cfap57 T C 4: 118,554,851 T1199A probably benign Het
Chga G A 12: 102,561,885 V212M probably benign Het
Cspp1 T A 1: 10,116,650 M887K probably damaging Het
Cyp3a16 G C 5: 145,469,624 A6G unknown Het
Cyp4f17 G T 17: 32,524,894 E349* probably null Het
Dnajc13 A T 9: 104,207,840 D791E probably benign Het
Dpysl5 T C 5: 30,778,053 Y167H probably benign Het
Dqx1 G T 6: 83,059,778 Q254H possibly damaging Het
Eef1g A G 19: 8,978,019 T411A probably benign Het
Fancl C A 11: 26,387,231 A6E probably benign Het
Gabrr3 A G 16: 59,407,467 Q29R probably benign Het
Gtf2h2 A C 13: 100,481,270 L168R probably damaging Het
Hacl1 T A 14: 31,616,381 Q413L probably benign Het
Hdc A T 2: 126,597,917 V372E probably damaging Het
Hr A T 14: 70,557,639 H208L possibly damaging Het
Htr6 T C 4: 139,062,190 R255G possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kank2 A G 9: 21,770,074 V747A probably damaging Het
Kif5c A G 2: 49,730,279 T508A probably benign Het
Klhdc8b A G 9: 108,449,728 V145A probably damaging Het
Klk1b21 T A 7: 44,105,500 V73D probably damaging Het
Ksr1 T A 11: 79,020,746 M737L probably benign Het
Macf1 T C 4: 123,434,771 Y4723C probably damaging Het
Mcm7 T C 5: 138,169,135 Y182C probably damaging Het
Mtf2 T C 5: 108,104,532 probably null Het
Nrxn2 A T 19: 6,448,269 T255S probably benign Het
Olfr1154 A T 2: 87,902,764 M304K probably benign Het
Olfr1418 A G 19: 11,855,302 L217P probably damaging Het
Olfr248 A T 1: 174,391,083 T5S probably damaging Het
Olfr30 T A 11: 58,455,173 T259S possibly damaging Het
Olfr552 T A 7: 102,604,978 I208N probably damaging Het
Olfr741 T C 14: 50,486,250 L264P probably damaging Het
Pamr1 T A 2: 102,634,421 V305E probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg10 C T 6: 4,757,128 T568M unknown Het
Prb1 T A 6: 132,208,343 N109I unknown Het
Prdm2 T C 4: 143,132,182 I1513V probably benign Het
Prkd3 A C 17: 78,962,540 V564G possibly damaging Het
Prss16 A G 13: 22,008,343 S151P probably damaging Het
Rnf150 C T 8: 82,863,959 probably benign Het
Rttn A G 18: 89,020,137 T786A probably benign Het
Scin A G 12: 40,063,237 V645A possibly damaging Het
Slc25a20 T A 9: 108,680,199 M177K probably benign Het
Slc2a6 G A 2: 27,024,322 S261L possibly damaging Het
Slc4a7 A T 14: 14,796,115 D1118V probably damaging Het
Slc7a2 T C 8: 40,905,672 W351R probably damaging Het
Sp8 G A 12: 118,848,439 G10S probably damaging Het
St8sia2 A G 7: 73,966,765 I175T probably damaging Het
Tas2r122 T A 6: 132,711,816 N38I probably benign Het
Trim31 C T 17: 36,898,490 T46M possibly damaging Het
Trim31 A G 17: 36,909,253 K354E probably benign Het
Trio G A 15: 27,749,836 Q2260* probably null Het
Trpm1 T C 7: 64,199,195 I63T probably benign Het
Ugt2b37 T C 5: 87,251,777 K291E probably benign Het
Usp54 T C 14: 20,577,094 T499A probably benign Het
Vmn1r35 T C 6: 66,678,949 I246V probably benign Het
Vmn2r6 A G 3: 64,556,856 S186P probably benign Het
Vmn2r76 T A 7: 86,229,962 M377L probably benign Het
Zeb2 A C 2: 44,988,625 M1243R possibly damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
R8753:Polr3a UTSW 14 24463634 nonsense probably null
R8785:Polr3a UTSW 14 24452315 missense probably benign 0.06
R8848:Polr3a UTSW 14 24450766 missense probably damaging 1.00
R9025:Polr3a UTSW 14 24469411 missense probably damaging 1.00
R9264:Polr3a UTSW 14 24470831 missense probably benign
R9309:Polr3a UTSW 14 24459999 missense probably benign
R9363:Polr3a UTSW 14 24450763 missense probably damaging 1.00
R9526:Polr3a UTSW 14 24453245 missense probably benign 0.00
R9585:Polr3a UTSW 14 24452221 missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCGACCTCACTGACATATGC -3'
(R):5'- GGAGGTCAGGACTTCTACTGTG -3'

Sequencing Primer
(F):5'- GCACAAATGACTTAACGTTTTGTCCG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2022-01-20