Mutagenetix > Incidental Mutation

Incidental Mutation 'R9140:Ago1'

694273

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.811) question?

Stock #

R9140 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 126443184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 547 (V547L)

Ref Sequence

ENSEMBL: ENSMUSP00000095498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

AlphaFold

Q8CJG1

Predicted Effect

probably benign
Transcript: ENSMUST00000097888
AA Change: V547L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: V547L

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000127800

Predicted Effect

probably benign
Transcript: ENSMUST00000176315
AA Change: V243L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: V243L

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	C	5: 9,399,226	V118A	probably benign	Het
Actl9	A	T	17: 33,433,196	I77F	possibly damaging	Het
Adgb	G	A	10: 10,340,519	R1509*	probably null	Het
Arhgap21	T	A	2: 20,881,214	Y394F	probably damaging	Het
C1qa	A	C	4: 136,896,242	I217S	probably damaging	Het
Cacna1b	T	A	2: 24,635,212	I1651F	probably damaging	Het
Car8	T	C	4: 8,183,270	T242A	probably benign	Het
Chrnb4	G	A	9: 55,034,671	H440Y		Het
Cic	T	C	7: 25,285,740	V1137A	probably damaging	Het
Ctdp1	C	T	18: 80,440,828		probably null	Het
Cyp3a16	G	C	5: 145,469,624	A6G	unknown	Het
Ddhd1	A	C	14: 45,657,461	L184R	probably benign	Het
Dnttip1	A	G	2: 164,754,162	D109G	possibly damaging	Het
Dsc3	T	A	18: 19,989,559	M103L	probably benign	Het
Dusp9	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	X: 73,640,611		probably benign	Het
Eya2	T	C	2: 165,767,057	L439S	probably damaging	Het
Eya3	A	G	4: 132,701,100	N311S	possibly damaging	Het
Fam151a	C	T	4: 106,748,147	R569*	probably null	Het
Fam208b	G	A	13: 3,588,441	T430I	probably benign	Het
Fer1l5	A	G	1: 36,420,966		probably benign	Het
Fnbp4	A	G	2: 90,745,733	T93A	unknown	Het
Fosl2	T	C	5: 32,152,698	S164P	probably damaging	Het
Galc	T	C	12: 98,207,414	T630A	probably null	Het
Gm5916	G	T	9: 36,120,686	Q101K	unknown	Het
Gm6583	A	T	5: 112,354,857	L327Q	probably damaging	Het
Gm7138	A	T	10: 77,776,848		probably benign	Het
Habp2	A	G	19: 56,319,502	K474R	probably benign	Het
Ibtk	A	G	9: 85,735,061	F153L	probably damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Jup	C	T	11: 100,379,565	C372Y	probably damaging	Het
Kirrel3	C	T	9: 35,013,300	A268V	probably benign	Het
Kprp	G	T	3: 92,825,151	Y197*	probably null	Het
Kri1	C	T	9: 21,276,138	R471H		Het
Krt17	C	A	11: 100,257,650	A322S	possibly damaging	Het
Leng9	A	T	7: 4,149,658	D6E	probably benign	Het
Macf1	A	T	4: 123,474,062	I2302K	possibly damaging	Het
Manba	G	A	3: 135,485,729	V17M	probably benign	Het
Micalcl	A	G	7: 112,407,619	K582E	probably damaging	Het
Mknk2	A	G	10: 80,671,593	V102A	probably benign	Het
Myh1	G	A	11: 67,209,263	G636D	probably benign	Het
Olfr638	A	G	7: 104,004,115	N280S	probably damaging	Het
P2rx7	G	A	5: 122,652,726		probably null	Het
Pcmt1	A	G	10: 7,638,914	*177R	probably null	Het
Pla2r1	T	C	2: 60,441,111	K959R	probably benign	Het
Plat	A	G	8: 22,780,546	D493G	probably damaging	Het
Prr30	A	G	14: 101,198,994	L44P	probably benign	Het
Ptx4	T	C	17: 25,125,206	C477R	probably damaging	Het
Pus10	A	G	11: 23,672,625	S82G	probably benign	Het
Pygo1	A	G	9: 72,945,706	T392A	probably benign	Het
Rad54b	C	A	4: 11,610,386	L668I	probably damaging	Het
Rdh19	A	C	10: 127,856,961	M166L		Het
Retnlg	C	A	16: 48,872,925	Q22K	possibly damaging	Het
Rfc3	G	T	5: 151,644,676	T249K	probably benign	Het
Rgs16	T	A	1: 153,743,635	V129E	probably damaging	Het
Rptn	T	A	3: 93,396,138	Y259*	probably null	Het
Sema6a	T	C	18: 47,281,942	N427S	probably benign	Het
Slc7a13	T	C	4: 19,819,487	I229T	possibly damaging	Het
Slitrk3	A	T	3: 73,050,459	Y327N	probably benign	Het
Smtnl2	A	G	11: 72,399,967	L384P	probably damaging	Het
Stil	G	T	4: 115,007,252	V117F	probably damaging	Het
Tada1	T	C	1: 166,388,608	V126A	probably benign	Het
Tmem30c	T	C	16: 57,270,119	I242V	probably damaging	Het
Tnnt2	T	A	1: 135,840,897	V8E		Het
Ttn	A	G	2: 76,943,896	V2268A	unknown	Het
Uspl1	G	T	5: 149,213,480	A497S	possibly damaging	Het
Vmn2r1	A	T	3: 64,090,044	N374Y	probably benign	Het
Vmn2r27	A	G	6: 124,192,248	F641S	probably damaging	Het
Vmn2r52	T	A	7: 10,158,716	Y832F	probably damaging	Het
Wisp1	G	A	15: 66,919,308	V320M	probably damaging	Het
Zfp748	C	T	13: 67,540,954	C729Y	probably damaging	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0195:Ago1	UTSW	4	126463691	missense	probably benign	0.01
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1104:Ago1	UTSW	4	126453633	missense	probably damaging	0.99
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2001:Ago1	UTSW	4	126454394	missense	probably null	0.36
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2517:Ago1	UTSW	4	126439939	nonsense	probably null
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R2993:Ago1	UTSW	4	126440046	splice site	probably benign
R3746:Ago1	UTSW	4	126461044	missense	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5239:Ago1	UTSW	4	126441215	missense	probably damaging	1.00
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7041:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8041:Ago1	UTSW	4	126441936	missense	probably damaging	1.00
R8073:Ago1	UTSW	4	126443226	missense	probably benign	0.04
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8772:Ago1	UTSW	4	126460523	unclassified	probably benign
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
R8989:Ago1	UTSW	4	126463790	missense	probably benign	0.01
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTCTTTGGCTGGCACCATC -3'
(R):5'- CCTGACTAAGTTATTACCCCGTG -3'

Sequencing Primer
(F):5'- TCTGTCACTCTGCCTGGAAAGG -3'
(R):5'- GCCAAATGCACTATTCAGT -3'

Posted On

2022-01-20