Mutagenetix > Incidental Mutation

Incidental Mutation 'V7580:Klc1'

69428

Institutional Source

Beutler Lab

Gene Symbol

Klc1

Ensembl Gene

ENSMUSG00000021288

Gene Name

kinesin light chain 1

Synonyms

Kns2

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.359) question?

Stock #

V7580 () of strain stinger

Quality Score

223

Status

Not validated

Chromosome

Chromosomal Location

111758849-111807844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 111774572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 161 (I161F)

Ref Sequence

ENSEMBL: ENSMUSP00000113997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084941] [ENSMUST00000118471] [ENSMUST00000120544] [ENSMUST00000122300]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000084941
AA Change: I161F

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000082004
Gene: ENSMUSG00000021288
AA Change: I161F

Domain	Start	End	E-Value	Type
coiled coil region	86	156	N/A	INTRINSIC
low complexity region	158	179	N/A	INTRINSIC
low complexity region	188	206	N/A	INTRINSIC
Pfam:TPR_10	212	253	3.1e-9	PFAM
TPR	255	288	3.81e-1	SMART
TPR	297	330	1.16e-5	SMART
TPR	339	372	4.77e-2	SMART
TPR	381	414	2.78e-3	SMART
TPR	464	497	4.93e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118471
AA Change: I161F

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000113171
Gene: ENSMUSG00000021288
AA Change: I161F

Domain	Start	End	E-Value	Type
Pfam:Rab5-bind	80	254	8.3e-69	PFAM
Pfam:TPR_10	212	253	7.2e-9	PFAM
TPR	255	288	3.81e-1	SMART
TPR	297	330	1.16e-5	SMART
TPR	339	372	4.77e-2	SMART
TPR	381	414	2.78e-3	SMART
TPR	464	497	4.93e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120544
AA Change: I161F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000113237
Gene: ENSMUSG00000021288
AA Change: I161F

Domain	Start	End	E-Value	Type
coiled coil region	86	156	N/A	INTRINSIC
low complexity region	158	179	N/A	INTRINSIC
low complexity region	188	206	N/A	INTRINSIC
Pfam:TPR_10	212	253	3.2e-9	PFAM
TPR	255	288	3.81e-1	SMART
TPR	297	330	1.16e-5	SMART
TPR	339	372	4.77e-2	SMART
TPR	381	414	2.78e-3	SMART
TPR	464	497	4.93e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122300
AA Change: I161F

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000113997
Gene: ENSMUSG00000021288
AA Change: I161F

Domain	Start	End	E-Value	Type
Pfam:Rab5-bind	80	254	1e-68	PFAM
Pfam:TPR_10	212	253	8.4e-9	PFAM
TPR	255	288	3.81e-1	SMART
TPR	297	330	1.16e-5	SMART
TPR	339	372	4.77e-2	SMART
TPR	381	414	2.78e-3	SMART
TPR	464	497	2.99e1	SMART

Meta Mutation Damage Score

0.0963

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Conventional kinesin is a tetrameric molecule composed of two heavy chains and two light chains, and transports various cargos along microtubules toward their plus ends. The heavy chains provide the motor activity, while the light chains bind to various cargos. This gene encodes a member of the kinesin light chain family. It associates with kinesin heavy chain through an N-terminal domain, and six tetratricopeptide repeat (TPR) motifs are thought to be involved in binding of cargos such as vesicles, mitochondria, and the Golgi complex. Thus, kinesin light chains function as adapter molecules and not motors per se. Although previously named "kinesin 2", this gene is not a member of the kinesin-2 / kinesin heavy chain subfamily of kinesin motor proteins. Extensive alternative splicing produces isoforms with different C-termini that are proposed to bind to different cargos; however, the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are significantly smaller than normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Med20	G	A	17: 47,618,832	V65M	probably damaging	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Klc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Klc1	APN	12	111776884	missense	probably damaging	1.00
IGL00940:Klc1	APN	12	111787498	missense	probably damaging	1.00
IGL02206:Klc1	APN	12	111778116	unclassified	probably benign
IGL02487:Klc1	APN	12	111772452	missense	probably damaging	0.99
IGL02490:Klc1	APN	12	111781776	missense	possibly damaging	0.89
IGL02830:Klc1	APN	12	111776907	missense	probably damaging	0.99
IGL03121:Klc1	APN	12	111781642	unclassified	probably benign
IGL03253:Klc1	APN	12	111781644	unclassified	probably benign
IGL03376:Klc1	APN	12	111775953	missense	probably damaging	0.97
dwarf	UTSW	12	111795603	missense	probably damaging	1.00
F5770:Klc1	UTSW	12	111774572	missense	probably benign	0.09
R0031:Klc1	UTSW	12	111777033	missense	probably damaging	0.99
R0239:Klc1	UTSW	12	111785324	splice site	probably benign
R1647:Klc1	UTSW	12	111776887	missense	probably damaging	1.00
R1648:Klc1	UTSW	12	111776887	missense	probably damaging	1.00
R1892:Klc1	UTSW	12	111781827	critical splice donor site	probably null
R2940:Klc1	UTSW	12	111806017	missense	possibly damaging	0.49
R4829:Klc1	UTSW	12	111795603	missense	probably damaging	1.00
R4849:Klc1	UTSW	12	111781695	missense	probably damaging	1.00
R5309:Klc1	UTSW	12	111795621	missense	possibly damaging	0.82
R5312:Klc1	UTSW	12	111795621	missense	possibly damaging	0.82
R5637:Klc1	UTSW	12	111774408	missense	probably damaging	1.00
R5706:Klc1	UTSW	12	111795627	missense	possibly damaging	0.65
R6623:Klc1	UTSW	12	111806041	missense	probably damaging	1.00
R6920:Klc1	UTSW	12	111787585	missense	probably damaging	1.00
R7109:Klc1	UTSW	12	111776865	missense	probably benign	0.22
R7538:Klc1	UTSW	12	111785445	missense	probably benign	0.01
R8051:Klc1	UTSW	12	111781950	missense	possibly damaging	0.58
R8719:Klc1	UTSW	12	111806075	critical splice donor site	probably benign
R8995:Klc1	UTSW	12	111776910	missense	probably damaging	1.00
R9420:Klc1	UTSW	12	111772516	missense	probably damaging	0.99
V7581:Klc1	UTSW	12	111774572	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CCAATCACCTGAATGCTGTGGAGTC -3'
(R):5'- GCAGAAGCACCAAGGAGCCTTATAC -3'

Sequencing Primer
(F):5'- CTGTGGAGTCCGAGAAGC -3'
(R):5'- tgcctggcctggtactc -3'

Posted On

2013-09-04