Mutagenetix > Incidental Mutation

Incidental Mutation 'V7580:Abcb5'

69429

Institutional Source

Beutler Lab

Gene Symbol

Abcb5

Ensembl Gene

ENSMUSG00000072791

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 5

Synonyms

9230106F14Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

V7580 () of strain stinger

Quality Score

172

Status

Not validated

Chromosome

Chromosomal Location

118867824-118966421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118886179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 950 (M950L)

Ref Sequence

ENSEMBL: ENSMUSP00000046177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035515]

AlphaFold

B5X0E4

Predicted Effect

probably benign
Transcript: ENSMUST00000035515
AA Change: M950L

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: M950L

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	49	338	1.9e-74	PFAM
AAA	414	606	2.1e-19	SMART
Pfam:ABC_membrane	693	967	7.3e-59	PFAM
Blast:AAA	969	1040	2e-11	BLAST
AAA	1043	1231	8.26e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100982

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177311

Meta Mutation Damage Score

0.0599

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Med20	G	A	17: 47,618,832	V65M	probably damaging	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Abcb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Abcb5	APN	12	118890610	missense	probably benign	0.03
IGL00092:Abcb5	APN	12	118928695	missense	probably benign	0.09
IGL00503:Abcb5	APN	12	118907601	missense	probably benign	0.02
IGL00776:Abcb5	APN	12	118919854	missense	probably damaging	1.00
IGL01116:Abcb5	APN	12	118886176	missense	probably benign
IGL01302:Abcb5	APN	12	118918200	missense	probably damaging	1.00
IGL01403:Abcb5	APN	12	118872867	missense	probably damaging	1.00
IGL01453:Abcb5	APN	12	118867970	missense	probably damaging	1.00
IGL01541:Abcb5	APN	12	118911434	missense	probably benign	0.03
IGL01784:Abcb5	APN	12	118890664	missense	probably benign	0.14
IGL01967:Abcb5	APN	12	118867972	missense	probably damaging	1.00
IGL01987:Abcb5	APN	12	118927358	missense	probably damaging	1.00
IGL02104:Abcb5	APN	12	118940680	missense	probably damaging	1.00
IGL02161:Abcb5	APN	12	118874755	missense	probably benign
IGL02292:Abcb5	APN	12	118918197	missense	probably damaging	1.00
IGL02381:Abcb5	APN	12	118940678	missense	probably damaging	1.00
IGL02544:Abcb5	APN	12	118906268	splice site	probably benign
IGL02685:Abcb5	APN	12	118905947	missense	probably damaging	0.99
IGL02824:Abcb5	APN	12	118890685	missense	probably benign	0.05
IGL02876:Abcb5	APN	12	118919841	missense	probably damaging	1.00
IGL02929:Abcb5	APN	12	118944939	missense	probably damaging	0.99
IGL03030:Abcb5	APN	12	118940369	missense	possibly damaging	0.93
IGL03062:Abcb5	APN	12	118936087	missense	probably benign	0.43
IGL03200:Abcb5	APN	12	118965254	splice site	probably benign
IGL03407:Abcb5	APN	12	118940376	missense	probably benign	0.01
alphabet	UTSW	12	118890618	missense	possibly damaging	0.67
google	UTSW	12	118867930	missense	possibly damaging	0.93
F5770:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
PIT4366001:Abcb5	UTSW	12	118936098	missense	probably damaging	1.00
PIT4434001:Abcb5	UTSW	12	118890687	missense	probably damaging	1.00
R0078:Abcb5	UTSW	12	118927394	missense	probably benign
R0219:Abcb5	UTSW	12	118886150	splice site	probably benign
R0312:Abcb5	UTSW	12	118872837	missense	probably damaging	1.00
R0347:Abcb5	UTSW	12	118965251	splice site	probably benign
R0359:Abcb5	UTSW	12	118940332	missense	probably damaging	1.00
R0433:Abcb5	UTSW	12	118877810	missense	probably benign	0.03
R0582:Abcb5	UTSW	12	118940412	missense	probably benign	0.40
R0815:Abcb5	UTSW	12	118901449	splice site	probably benign
R0900:Abcb5	UTSW	12	118940624	missense	probably damaging	1.00
R0942:Abcb5	UTSW	12	118906198	missense	possibly damaging	0.94
R0988:Abcb5	UTSW	12	118932575	missense	probably benign	0.36
R1125:Abcb5	UTSW	12	118911547	missense	possibly damaging	0.87
R1437:Abcb5	UTSW	12	118874762	missense	probably damaging	0.99
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1678:Abcb5	UTSW	12	118965329	start gained	probably benign
R1726:Abcb5	UTSW	12	118874801	splice site	probably null
R1726:Abcb5	UTSW	12	118907532	missense	possibly damaging	0.95
R1836:Abcb5	UTSW	12	118867961	missense	possibly damaging	0.93
R1934:Abcb5	UTSW	12	118907500	splice site	probably null
R1976:Abcb5	UTSW	12	118890682	missense	probably benign
R2005:Abcb5	UTSW	12	118877827	missense	probably benign	0.15
R2068:Abcb5	UTSW	12	118940568	nonsense	probably null
R2181:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R2191:Abcb5	UTSW	12	118867956	missense	probably damaging	1.00
R3690:Abcb5	UTSW	12	118872933	missense	probably damaging	1.00
R3746:Abcb5	UTSW	12	118874620	missense	probably damaging	0.99
R3825:Abcb5	UTSW	12	118901352	splice site	probably null
R3919:Abcb5	UTSW	12	118890618	missense	possibly damaging	0.67
R4049:Abcb5	UTSW	12	118868669	missense	probably damaging	0.99
R4409:Abcb5	UTSW	12	118872922	missense	probably damaging	0.98
R4606:Abcb5	UTSW	12	118932610	critical splice acceptor site	probably null
R4705:Abcb5	UTSW	12	118965305	missense	possibly damaging	0.95
R4954:Abcb5	UTSW	12	118911434	missense	probably benign	0.03
R4966:Abcb5	UTSW	12	118886891	intron	probably benign
R5169:Abcb5	UTSW	12	118877817	nonsense	probably null
R5327:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R5333:Abcb5	UTSW	12	118867942	missense	probably damaging	1.00
R5366:Abcb5	UTSW	12	118867930	missense	possibly damaging	0.93
R5373:Abcb5	UTSW	12	118887177	missense	probably damaging	1.00
R5399:Abcb5	UTSW	12	118911499	missense	probably benign
R5416:Abcb5	UTSW	12	118907596	missense	probably damaging	1.00
R5447:Abcb5	UTSW	12	118927326	missense	probably damaging	1.00
R5474:Abcb5	UTSW	12	118940690	missense	probably null	1.00
R5566:Abcb5	UTSW	12	118935967	missense	probably damaging	0.99
R5685:Abcb5	UTSW	12	118932613	splice site	probably null
R5691:Abcb5	UTSW	12	118927235	missense	probably damaging	0.99
R5742:Abcb5	UTSW	12	118918257	missense	probably damaging	0.96
R5852:Abcb5	UTSW	12	118927404	missense	probably damaging	0.99
R5917:Abcb5	UTSW	12	118868781	nonsense	probably null
R5994:Abcb5	UTSW	12	118965260	critical splice donor site	probably null
R6295:Abcb5	UTSW	12	118874644	missense	probably damaging	0.99
R6455:Abcb5	UTSW	12	118890549	critical splice donor site	probably null
R6609:Abcb5	UTSW	12	118928762	missense	probably damaging	1.00
R6753:Abcb5	UTSW	12	118944906	missense	possibly damaging	0.86
R6818:Abcb5	UTSW	12	118901354	splice site	probably null
R6870:Abcb5	UTSW	12	118965265	missense	possibly damaging	0.87
R6944:Abcb5	UTSW	12	118911530	missense	probably benign	0.06
R6957:Abcb5	UTSW	12	118907535	missense	probably damaging	1.00
R6984:Abcb5	UTSW	12	118927277	missense	possibly damaging	0.47
R7021:Abcb5	UTSW	12	118931925	missense	probably benign	0.00
R7061:Abcb5	UTSW	12	118877774	missense	probably damaging	1.00
R7175:Abcb5	UTSW	12	118867876	missense	probably benign	0.00
R7239:Abcb5	UTSW	12	118928725	missense	probably benign	0.19
R7267:Abcb5	UTSW	12	118952470	missense	probably damaging	1.00
R7303:Abcb5	UTSW	12	118911560	missense	probably damaging	0.96
R7396:Abcb5	UTSW	12	118867874	missense	probably damaging	1.00
R7605:Abcb5	UTSW	12	118918164	missense	probably damaging	1.00
R7989:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R8177:Abcb5	UTSW	12	118872790	missense	possibly damaging	0.65
R8296:Abcb5	UTSW	12	118874732	missense	probably benign	0.01
R8544:Abcb5	UTSW	12	118868726	missense	probably damaging	1.00
R8558:Abcb5	UTSW	12	118877831	missense	probably benign	0.07
R8790:Abcb5	UTSW	12	118867885	missense	possibly damaging	0.91
R9003:Abcb5	UTSW	12	118886278	missense	possibly damaging	0.93
R9038:Abcb5	UTSW	12	118931916	missense	probably benign
R9410:Abcb5	UTSW	12	118905968	missense	probably benign	0.00
R9497:Abcb5	UTSW	12	118936115	missense	probably damaging	0.96
R9666:Abcb5	UTSW	12	118874687	missense	probably damaging	0.98
R9682:Abcb5	UTSW	12	118932593	missense	probably damaging	0.99
R9756:Abcb5	UTSW	12	118918138	missense	probably damaging	0.98
Z1176:Abcb5	UTSW	12	118918272	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCAAGTTTAGCTATGCTGTGCTCC -3'
(R):5'- AAAGGTCTCAACGTTCACCACTCTG -3'

Sequencing Primer
(F):5'- tgttaaaacatggtagtttgtcctg -3'
(R):5'- AACGTTCACCACTCTGAGTTTATTC -3'

Posted On

2013-09-04