Incidental Mutation 'R9140:Chrnb4'
ID 694295
Institutional Source Beutler Lab
Gene Symbol Chrnb4
Ensembl Gene ENSMUSG00000035200
Gene Name cholinergic receptor, nicotinic, beta polypeptide 4
Synonyms Acrb-4, Acrb4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R9140 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 55028154-55048779 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55034671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 440 (H440Y)
Ref Sequence ENSEMBL: ENSMUSP00000034854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034854]
AlphaFold Q8R493
Predicted Effect
SMART Domains Protein: ENSMUSP00000034854
Gene: ENSMUSG00000035200
AA Change: H440Y

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 231 3.2e-70 PFAM
Pfam:Neur_chan_memb 238 481 6.1e-88 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in hyperplasia of the bladder and altered bladder contractility. Mutant mice also exhibit a resistance to nicotine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,399,226 V118A probably benign Het
Actl9 A T 17: 33,433,196 I77F possibly damaging Het
Adgb G A 10: 10,340,519 R1509* probably null Het
Ago1 C A 4: 126,443,184 V547L probably benign Het
Arhgap21 T A 2: 20,881,214 Y394F probably damaging Het
C1qa A C 4: 136,896,242 I217S probably damaging Het
Cacna1b T A 2: 24,635,212 I1651F probably damaging Het
Car8 T C 4: 8,183,270 T242A probably benign Het
Cic T C 7: 25,285,740 V1137A probably damaging Het
Ctdp1 C T 18: 80,440,828 probably null Het
Cyp3a16 G C 5: 145,469,624 A6G unknown Het
Ddhd1 A C 14: 45,657,461 L184R probably benign Het
Dnttip1 A G 2: 164,754,162 D109G possibly damaging Het
Dsc3 T A 18: 19,989,559 M103L probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eya2 T C 2: 165,767,057 L439S probably damaging Het
Eya3 A G 4: 132,701,100 N311S possibly damaging Het
Fam151a C T 4: 106,748,147 R569* probably null Het
Fam208b G A 13: 3,588,441 T430I probably benign Het
Fnbp4 A G 2: 90,745,733 T93A unknown Het
Fosl2 T C 5: 32,152,698 S164P probably damaging Het
Galc T C 12: 98,207,414 T630A probably null Het
Gm5916 G T 9: 36,120,686 Q101K unknown Het
Gm6583 A T 5: 112,354,857 L327Q probably damaging Het
Gm7138 A T 10: 77,776,848 probably benign Het
Habp2 A G 19: 56,319,502 K474R probably benign Het
Ibtk A G 9: 85,735,061 F153L probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kirrel3 C T 9: 35,013,300 A268V probably benign Het
Kprp G T 3: 92,825,151 Y197* probably null Het
Kri1 C T 9: 21,276,138 R471H Het
Krt17 C A 11: 100,257,650 A322S possibly damaging Het
Leng9 A T 7: 4,149,658 D6E probably benign Het
Macf1 A T 4: 123,474,062 I2302K possibly damaging Het
Manba G A 3: 135,485,729 V17M probably benign Het
Micalcl A G 7: 112,407,619 K582E probably damaging Het
Mknk2 A G 10: 80,671,593 V102A probably benign Het
Myh1 G A 11: 67,209,263 G636D probably benign Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr638 A G 7: 104,004,115 N280S probably damaging Het
P2rx7 G A 5: 122,652,726 probably null Het
Pcmt1 A G 10: 7,638,914 *177R probably null Het
Pla2r1 T C 2: 60,441,111 K959R probably benign Het
Plat A G 8: 22,780,546 D493G probably damaging Het
Prr30 A G 14: 101,198,994 L44P probably benign Het
Ptx4 T C 17: 25,125,206 C477R probably damaging Het
Pus10 A G 11: 23,672,625 S82G probably benign Het
Pygo1 A G 9: 72,945,706 T392A probably benign Het
Rad54b C A 4: 11,610,386 L668I probably damaging Het
Rdh19 A C 10: 127,856,961 M166L Het
Retnlg C A 16: 48,872,925 Q22K possibly damaging Het
Rfc3 G T 5: 151,644,676 T249K probably benign Het
Rgs16 T A 1: 153,743,635 V129E probably damaging Het
Rptn T A 3: 93,396,138 Y259* probably null Het
Sema6a T C 18: 47,281,942 N427S probably benign Het
Slc7a13 T C 4: 19,819,487 I229T possibly damaging Het
Slitrk3 A T 3: 73,050,459 Y327N probably benign Het
Smtnl2 A G 11: 72,399,967 L384P probably damaging Het
Stil G T 4: 115,007,252 V117F probably damaging Het
Tada1 T C 1: 166,388,608 V126A probably benign Het
Tmem30c T C 16: 57,270,119 I242V probably damaging Het
Tnnt2 T A 1: 135,840,897 V8E Het
Ttn A G 2: 76,943,896 V2268A unknown Het
Uspl1 G T 5: 149,213,480 A497S possibly damaging Het
Vmn2r1 A T 3: 64,090,044 N374Y probably benign Het
Vmn2r27 A G 6: 124,192,248 F641S probably damaging Het
Vmn2r52 T A 7: 10,158,716 Y832F probably damaging Het
Wisp1 G A 15: 66,919,308 V320M probably damaging Het
Zfp748 C T 13: 67,540,954 C729Y probably damaging Het
Other mutations in Chrnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Chrnb4 APN 9 55036594 missense probably damaging 1.00
IGL02207:Chrnb4 APN 9 55035216 missense probably damaging 1.00
IGL03242:Chrnb4 APN 9 55035528 missense probably damaging 1.00
R0345:Chrnb4 UTSW 9 55035594 missense probably benign
R0735:Chrnb4 UTSW 9 55043800 missense probably damaging 0.96
R1843:Chrnb4 UTSW 9 55034818 missense possibly damaging 0.93
R1975:Chrnb4 UTSW 9 55034818 missense probably damaging 0.99
R2204:Chrnb4 UTSW 9 55043848 missense probably damaging 1.00
R2427:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R3876:Chrnb4 UTSW 9 55043898 missense probably damaging 1.00
R4934:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R5094:Chrnb4 UTSW 9 55035313 missense probably benign 0.00
R5507:Chrnb4 UTSW 9 55035012 missense probably damaging 1.00
R6370:Chrnb4 UTSW 9 55034859 missense probably benign 0.00
R7556:Chrnb4 UTSW 9 55035055 missense probably benign 0.19
R8399:Chrnb4 UTSW 9 55043823 missense probably benign 0.02
R9352:Chrnb4 UTSW 9 55043883 missense probably benign 0.07
X0062:Chrnb4 UTSW 9 55034680 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGACCTCTTCAAATCCACTG -3'
(R):5'- ATCCAACCTCTATGGGAATTCC -3'

Sequencing Primer
(F):5'- ATCCAAGGGCTGTTGTCAAC -3'
(R):5'- GGGAATTCCATGTACTTTGTGAACCC -3'
Posted On 2022-01-20