Mutagenetix > Incidental Mutation

Incidental Mutation 'V7580:Spata31'

69430

Institutional Source

Beutler Lab

Gene Symbol

Spata31

Ensembl Gene

ENSMUSG00000056223

Gene Name

spermatogenesis associated 31

Synonyms

4930458L03Rik, Fam75a, Spata31a

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.404) question?

Stock #

V7580 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64917406-64923194 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 64921648 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 537 (P537T)

Ref Sequence

ENSEMBL: ENSMUSP00000097025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070216] [ENSMUST00000221202]

AlphaFold

E9QAF0

Predicted Effect

probably benign
Transcript: ENSMUST00000070216
AA Change: P537T

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000097025
Gene: ENSMUSG00000056223
AA Change: P537T

Domain	Start	End	E-Value	Type
low complexity region	35	45	N/A	INTRINSIC
low complexity region	91	106	N/A	INTRINSIC
Pfam:FAM75	149	431	1.7e-83	PFAM
Pfam:FAM75	426	462	4.5e-9	PFAM
low complexity region	478	491	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221202

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Med20	G	A	17: 47,618,832	V65M	probably damaging	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Spata31

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00663:Spata31	APN	13	64922788	nonsense	probably null
IGL01143:Spata31	APN	13	64920816	nonsense	probably null
IGL01321:Spata31	APN	13	64921754	missense	probably benign	0.01
IGL01624:Spata31	APN	13	64921585	missense	probably damaging	1.00
IGL01844:Spata31	APN	13	64921154	missense	possibly damaging	0.49
IGL02259:Spata31	APN	13	64921483	missense	possibly damaging	0.90
IGL02358:Spata31	APN	13	64921218	missense	probably benign
IGL02377:Spata31	APN	13	64920380	missense	probably damaging	0.98
IGL02723:Spata31	APN	13	64920649	missense	probably benign	0.10
IGL03125:Spata31	APN	13	64920889	missense	probably benign	0.09
IGL03343:Spata31	APN	13	64919773	missense	probably benign	0.41
BB006:Spata31	UTSW	13	64921718	missense	probably benign	0.04
BB016:Spata31	UTSW	13	64921718	missense	probably benign	0.04
F5770:Spata31	UTSW	13	64921648	missense	probably benign	0.18
IGL02991:Spata31	UTSW	13	64920719	missense	probably benign	0.05
P0043:Spata31	UTSW	13	64921006	splice site	probably null
PIT4366001:Spata31	UTSW	13	64921505	nonsense	probably null
PIT4458001:Spata31	UTSW	13	64921850	missense	probably benign	0.01
PIT4687001:Spata31	UTSW	13	64921337	missense	probably benign	0.02
R0042:Spata31	UTSW	13	64922563	missense	probably benign	0.00
R0042:Spata31	UTSW	13	64922563	missense	probably benign	0.00
R0064:Spata31	UTSW	13	64922098	missense	probably damaging	0.98
R0064:Spata31	UTSW	13	64922098	missense	probably damaging	0.98
R0639:Spata31	UTSW	13	64922213	missense	probably benign	0.02
R1253:Spata31	UTSW	13	64922024	missense	probably benign	0.23
R1536:Spata31	UTSW	13	64921382	missense	probably damaging	1.00
R1656:Spata31	UTSW	13	64921139	missense	probably benign
R1802:Spata31	UTSW	13	64922383	missense	probably benign	0.01
R1813:Spata31	UTSW	13	64921798	missense	probably benign	0.32
R1916:Spata31	UTSW	13	64922545	nonsense	probably null
R1917:Spata31	UTSW	13	64920865	missense	possibly damaging	0.92
R1933:Spata31	UTSW	13	64920610	missense	probably benign	0.02
R2910:Spata31	UTSW	13	64920436	missense	probably benign	0.12
R3750:Spata31	UTSW	13	64921743	missense	probably benign	0.01
R3876:Spata31	UTSW	13	64920931	missense	probably benign	0.03
R3980:Spata31	UTSW	13	64922654	missense	probably benign	0.24
R4056:Spata31	UTSW	13	64921655	missense	probably benign	0.00
R4300:Spata31	UTSW	13	64919761	missense	probably benign	0.08
R4797:Spata31	UTSW	13	64922742	nonsense	probably null
R4997:Spata31	UTSW	13	64919723	missense	probably benign	0.00
R5185:Spata31	UTSW	13	64917526	missense	possibly damaging	0.93
R5366:Spata31	UTSW	13	64920459	missense	probably damaging	0.98
R5539:Spata31	UTSW	13	64922969	missense	probably benign	0.00
R5704:Spata31	UTSW	13	64922041	missense	probably benign	0.32
R5748:Spata31	UTSW	13	64920313	makesense	probably null
R5834:Spata31	UTSW	13	64922666	missense	probably benign	0.19
R5926:Spata31	UTSW	13	64920725	missense	possibly damaging	0.82
R6476:Spata31	UTSW	13	64917642	missense	possibly damaging	0.68
R6603:Spata31	UTSW	13	64922665	missense	probably damaging	1.00
R6620:Spata31	UTSW	13	64919757	missense	possibly damaging	0.68
R6965:Spata31	UTSW	13	64922834	missense	possibly damaging	0.90
R7086:Spata31	UTSW	13	64922229	missense	probably benign	0.02
R7140:Spata31	UTSW	13	64921099	missense	probably benign
R7396:Spata31	UTSW	13	64920733	missense	probably benign
R7545:Spata31	UTSW	13	64922545	nonsense	probably null
R7575:Spata31	UTSW	13	64922912	missense	unknown
R7607:Spata31	UTSW	13	64921592	missense	probably damaging	1.00
R7929:Spata31	UTSW	13	64921718	missense	probably benign	0.04
R8024:Spata31	UTSW	13	64922804	missense	probably benign	0.12
R8088:Spata31	UTSW	13	64920865	missense	probably benign	0.31
R8323:Spata31	UTSW	13	64922251	missense	possibly damaging	0.61
R8362:Spata31	UTSW	13	64922230	missense	possibly damaging	0.58
R8870:Spata31	UTSW	13	64921004	missense	probably benign
R9429:Spata31	UTSW	13	64922522	missense	probably benign	0.43
R9465:Spata31	UTSW	13	64920713	missense	probably damaging	1.00
R9542:Spata31	UTSW	13	64922263	missense	probably damaging	0.96
R9627:Spata31	UTSW	13	64917595	missense	possibly damaging	0.95
V7581:Spata31	UTSW	13	64921648	missense	probably benign	0.18
V7583:Spata31	UTSW	13	64921648	missense	probably benign	0.18
Z1176:Spata31	UTSW	13	64921972	nonsense	probably null
Z1177:Spata31	UTSW	13	64921972	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAATCCTGGCTTGCTGTGGATG -3'
(R):5'- TGGCCCTCTTACAGGAAGGAGATG -3'

Sequencing Primer
(F):5'- CGAGATGGAAAACAATTTAACATCC -3'
(R):5'- CTCTTACAGGAAGGAGATGAGACAAG -3'

Posted On

2013-09-04