Incidental Mutation 'V7580:Dnajc22'
ID 69437
Institutional Source Beutler Lab
Gene Symbol Dnajc22
Ensembl Gene ENSMUSG00000038009
Gene Name DnaJ heat shock protein family (Hsp40) member C22
Synonyms 2810451A06Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # V7580 () of strain stinger
Quality Score 184
Status Not validated
Chromosome 15
Chromosomal Location 98991102-99002618 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98999363 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 183 (Y183N)
Ref Sequence ENSEMBL: ENSMUSP00000055482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061295]
AlphaFold Q8CHS2
Predicted Effect probably damaging
Transcript: ENSMUST00000061295
AA Change: Y183N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055482
Gene: ENSMUSG00000038009
AA Change: Y183N

DomainStartEndE-ValueType
Pfam:TM2 1 50 1e-10 PFAM
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
DnaJ 276 335 1.09e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146173
Meta Mutation Damage Score 0.3928 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,849,914 (GRCm39) M950L probably benign Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 (GRCm39) H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 18,025,526 (GRCm39) probably null Het
Cfi T A 3: 129,648,641 (GRCm39) I175K possibly damaging Het
D630003M21Rik T C 2: 158,042,931 (GRCm39) T870A probably benign Het
Dnah12 T A 14: 26,495,050 (GRCm39) N1369K possibly damaging Het
Erv3 T C 2: 131,697,846 (GRCm39) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Gm10770 T A 2: 150,021,404 (GRCm39) K38* probably null Het
Gm4787 G A 12: 81,424,341 (GRCm39) Q606* probably null Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Klc1 A T 12: 111,741,006 (GRCm39) I161F probably benign Het
Lpar5 C A 6: 125,058,690 (GRCm39) A137E possibly damaging Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Lrrc37a T G 11: 103,346,338 (GRCm39) N3176T possibly damaging Het
Med20 G A 17: 47,929,757 (GRCm39) V65M probably damaging Het
Mylk G T 16: 34,815,574 (GRCm39) probably null Het
Numbl T C 7: 26,979,027 (GRCm39) S379P probably benign Het
Or10j7 G T 1: 173,011,531 (GRCm39) L157I probably benign Het
Or5an6 G A 19: 12,371,914 (GRCm39) V96I probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Papln C T 12: 83,825,608 (GRCm39) R608C possibly damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pigx T C 16: 31,906,240 (GRCm39) D129G probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Plekhb1 T C 7: 100,303,825 (GRCm39) T112A probably benign Het
Ppwd1 A G 13: 104,356,745 (GRCm39) Y257H probably damaging Het
Recql4 T C 15: 76,590,369 (GRCm39) D705G possibly damaging Het
Ror1 A G 4: 100,298,130 (GRCm39) Q501R probably damaging Het
Slc30a4 T A 2: 122,531,458 (GRCm39) M136L probably benign Het
Spaca1 T C 4: 34,039,311 (GRCm39) E192G probably damaging Het
Spata31 C A 13: 65,069,462 (GRCm39) P537T probably benign Het
Sptbn2 C T 19: 4,800,660 (GRCm39) R2292C probably damaging Het
Tnrc6c G A 11: 117,614,152 (GRCm39) R770H probably damaging Het
Trps1 T C 15: 50,694,973 (GRCm39) K150E probably damaging Het
Tspyl3 A G 2: 153,066,980 (GRCm39) V86A probably benign Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zmynd8 G A 2: 165,654,314 (GRCm39) R724* probably null Het
Other mutations in Dnajc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dnajc22 APN 15 98,999,059 (GRCm39) missense possibly damaging 0.73
IGL00922:Dnajc22 APN 15 98,999,460 (GRCm39) missense possibly damaging 0.89
IGL02155:Dnajc22 APN 15 98,998,886 (GRCm39) missense probably damaging 1.00
IGL02726:Dnajc22 APN 15 98,998,881 (GRCm39) missense probably damaging 1.00
IGL03074:Dnajc22 APN 15 98,999,403 (GRCm39) missense probably damaging 1.00
F5770:Dnajc22 UTSW 15 98,999,363 (GRCm39) missense probably damaging 0.99
R1138:Dnajc22 UTSW 15 99,002,308 (GRCm39) small deletion probably benign
R1628:Dnajc22 UTSW 15 98,998,817 (GRCm39) start codon destroyed probably null 1.00
R2018:Dnajc22 UTSW 15 98,999,114 (GRCm39) missense probably benign 0.06
R2146:Dnajc22 UTSW 15 99,002,264 (GRCm39) missense probably benign 0.04
R4342:Dnajc22 UTSW 15 99,002,345 (GRCm39) nonsense probably null
R4950:Dnajc22 UTSW 15 98,999,615 (GRCm39) missense probably benign 0.29
R7123:Dnajc22 UTSW 15 98,999,085 (GRCm39) missense possibly damaging 0.89
R7173:Dnajc22 UTSW 15 98,999,187 (GRCm39) missense probably benign 0.06
R7640:Dnajc22 UTSW 15 98,998,995 (GRCm39) missense probably damaging 1.00
R7997:Dnajc22 UTSW 15 98,999,514 (GRCm39) missense probably damaging 1.00
R8338:Dnajc22 UTSW 15 98,999,022 (GRCm39) missense probably benign 0.00
R8745:Dnajc22 UTSW 15 98,999,345 (GRCm39) missense probably benign 0.01
V7581:Dnajc22 UTSW 15 98,999,363 (GRCm39) missense probably damaging 0.99
V7582:Dnajc22 UTSW 15 98,999,363 (GRCm39) missense probably damaging 0.99
V7583:Dnajc22 UTSW 15 98,999,363 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTTGGTAACCAGACCTCAGAC -3'
(R):5'- TCATGCAAGCTACAAGCTCCTGC -3'

Sequencing Primer
(F):5'- CTTTAAGAATACCTTAGGAGCGGC -3'
(R):5'- TCTCTGAGGAGACTTACCCGAAG -3'
Posted On 2013-09-04