Incidental Mutation 'R9142:Adprhl2'
ID 694378
Institutional Source Beutler Lab
Gene Symbol Adprhl2
Ensembl Gene ENSMUSG00000042558
Gene Name ADP-ribosylhydrolase like 2
Synonyms Arh3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9142 (G1)
Quality Score 178.009
Status Not validated
Chromosome 4
Chromosomal Location 126316047-126321703 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 126321567 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 35 (G35V)
Ref Sequence ENSEMBL: ENSMUSP00000099677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030658] [ENSMUST00000102616] [ENSMUST00000102617] [ENSMUST00000131113] [ENSMUST00000141990]
AlphaFold Q8CG72
PDB Structure Crystal Structure of mouse ADP-ribosylhydrolase 3 (mARH3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030658
SMART Domains Protein: ENSMUSP00000030658
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 399 2.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102616
SMART Domains Protein: ENSMUSP00000099676
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 398 1.9e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102617
AA Change: G35V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558
AA Change: G35V

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131113
SMART Domains Protein: ENSMUSP00000116659
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 126 9.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141990
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADP-ribosylglycohydrolase family. The encoded enzyme catalyzes the removal of ADP-ribose from ADP-ribosylated proteins. This enzyme localizes to the mitochondria, in addition to the nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,297,893 D929E probably damaging Het
Apob A C 12: 8,012,705 D3729A possibly damaging Het
App G A 16: 85,103,239 H108Y probably damaging Het
Arap3 G A 18: 37,979,881 A1092V possibly damaging Het
Arid3a T C 10: 79,951,778 S550P unknown Het
Armc2 T G 10: 41,975,408 E259D probably benign Het
Atp13a2 A G 4: 141,002,053 D566G probably damaging Het
Bnc2 A G 4: 84,555,874 C12R probably benign Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Cc2d2b C T 19: 40,765,401 R123* probably null Het
Cdc37l1 T A 19: 29,012,002 H286Q possibly damaging Het
Cfap54 A T 10: 92,984,235 L1239Q possibly damaging Het
Cfap58 T C 19: 47,986,554 probably null Het
Col6a3 A T 1: 90,778,844 D2789E unknown Het
Dazl A G 17: 50,283,150 V271A probably benign Het
Dennd4c A T 4: 86,837,400 N1610Y probably benign Het
Dusp13 T A 14: 21,742,688 K56N probably benign Het
Erbb2 T A 11: 98,422,058 I149N probably damaging Het
Erbb4 A T 1: 68,349,393 C217S probably damaging Het
Fbxw21 A G 9: 109,156,345 C122R probably damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Foxm1 T A 6: 128,367,335 I182N probably damaging Het
Ggnbp2 T C 11: 84,840,060 N381S possibly damaging Het
Gja3 T C 14: 57,036,591 E108G probably benign Het
Gm40460 C A 7: 142,240,762 G106V unknown Het
Gm9736 A G 10: 77,751,015 C114R unknown Het
Gpbp1 A T 13: 111,426,499 D492E unknown Het
Gper1 T C 5: 139,426,557 V219A possibly damaging Het
Gtf2e1 C T 16: 37,536,002 R56Q probably benign Het
Hist1h2af T C 13: 23,533,981 L24P probably damaging Het
Ide T C 19: 37,330,499 N38S Het
Kat6a T A 8: 22,940,056 M1809K unknown Het
Kif7 A T 7: 79,706,837 M702K probably benign Het
Lrrtm4 T A 6: 80,022,443 N279K probably damaging Het
Mcrip1 G A 11: 120,544,716 P31L probably damaging Het
Nf1 T A 11: 79,471,489 S1497R probably damaging Het
Nf1 T A 11: 79,475,862 I1607N probably damaging Het
Nrde2 G T 12: 100,151,259 T47K probably benign Het
Olfr1135 C T 2: 87,671,969 V133I probably benign Het
Olfr1415 T G 1: 92,491,689 E22A probably benign Het
Olfr802 T C 10: 129,682,416 T108A probably benign Het
Ppargc1a G A 5: 51,494,804 T184I possibly damaging Het
Ppp1r15a T C 7: 45,524,496 D296G probably damaging Het
Prl7c1 C T 13: 27,780,768 probably benign Het
Prss42 G T 9: 110,799,160 R124L possibly damaging Het
Psmd1 T G 1: 86,137,095 Y950D probably damaging Het
Ptprr A T 10: 116,188,214 L250F possibly damaging Het
Rabgef1 T A 5: 130,208,713 M208K possibly damaging Het
Rps6ka2 A G 17: 7,170,394 Y17C probably damaging Het
Rrnad1 A G 3: 87,923,888 I444T probably benign Het
Sec23ip T A 7: 128,761,502 C463S probably damaging Het
Serpina3n A G 12: 104,413,451 T368A probably damaging Het
Sez6l C T 5: 112,461,217 A589T probably benign Het
Spag5 T A 11: 78,301,997 Y52N possibly damaging Het
Tenm3 G A 8: 48,335,513 S494L unknown Het
Top3b T C 16: 16,883,435 Y204H probably damaging Het
Trim43b C T 9: 89,091,399 V94M possibly damaging Het
Trps1 T G 15: 50,661,262 I1091L probably damaging Het
Ttk G A 9: 83,843,688 R221Q probably damaging Het
Ttn A C 2: 76,719,122 M31737R probably damaging Het
Uso1 T A 5: 92,187,266 L495* probably null Het
Usp19 A G 9: 108,495,085 D447G possibly damaging Het
Zdhhc2 A G 8: 40,467,522 E274G probably damaging Het
Zfp106 T A 2: 120,520,454 Y1595F probably damaging Het
Zfp932 A T 5: 110,009,654 H406L probably damaging Het
Other mutations in Adprhl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Adprhl2 APN 4 126318481 missense probably damaging 1.00
IGL02391:Adprhl2 APN 4 126317908 splice site probably benign
IGL03189:Adprhl2 APN 4 126317294 splice site probably benign
R0139:Adprhl2 UTSW 4 126318154 missense probably damaging 1.00
R0302:Adprhl2 UTSW 4 126317392 missense probably benign 0.00
R0879:Adprhl2 UTSW 4 126316617 missense probably benign
R2008:Adprhl2 UTSW 4 126317344 missense probably benign 0.05
R3789:Adprhl2 UTSW 4 126316751 missense probably damaging 0.96
R5038:Adprhl2 UTSW 4 126317309 missense possibly damaging 0.69
R5058:Adprhl2 UTSW 4 126318445 missense probably damaging 1.00
R5724:Adprhl2 UTSW 4 126318076 missense probably damaging 1.00
R6171:Adprhl2 UTSW 4 126317317 missense probably damaging 1.00
R6326:Adprhl2 UTSW 4 126316613 missense possibly damaging 0.58
R7825:Adprhl2 UTSW 4 126321696 unclassified probably benign
R8552:Adprhl2 UTSW 4 126316575 makesense probably null
R9008:Adprhl2 UTSW 4 126316839 missense probably damaging 1.00
Z1176:Adprhl2 UTSW 4 126321567 missense probably damaging 1.00
Z1176:Adprhl2 UTSW 4 126321661 missense unknown
Predicted Primers PCR Primer
(F):5'- TCATGGCTGGAGACCTACAACC -3'
(R):5'- TAGGACGTAGGCTGAGACTC -3'

Sequencing Primer
(F):5'- GCTGGAGCAAACCGATTCGATC -3'
(R):5'- TGAGACTCCGGGCCACAAG -3'
Posted On 2022-01-20