Mutagenetix > Incidental Mutation

Incidental Mutation 'R9142:Nf1'

694409

Institutional Source

Beutler Lab

Gene Symbol

Nf1

Ensembl Gene

ENSMUSG00000020716

Gene Name

neurofibromin 1

Synonyms

Nf-1, neurofibromin

MMRRC Submission

Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9142 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

79339693-79581612 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79471489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1497 (S1497R)

Ref Sequence

ENSEMBL: ENSMUSP00000071289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071325
AA Change: S1497R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: S1497R

Domain	Start	End	E-Value	Type
RasGAP	1189	1559	2.56e-151	SMART
SEC14	1585	1737	2.36e-11	SMART
low complexity region	2619	2629	N/A	INTRINSIC
low complexity region	2750	2763	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108251
AA Change: S1476R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: S1476R

Domain	Start	End	E-Value	Type
RasGAP	1189	1538	1.23e-153	SMART
SEC14	1564	1716	2.36e-11	SMART
low complexity region	2598	2608	N/A	INTRINSIC
low complexity region	2729	2742	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	T	A	7: 140,297,893	D929E	probably damaging	Het
Adprhl2	C	A	4: 126,321,567	G35V	probably damaging	Het
Apob	A	C	12: 8,012,705	D3729A	possibly damaging	Het
App	G	A	16: 85,103,239	H108Y	probably damaging	Het
Arap3	G	A	18: 37,979,881	A1092V	possibly damaging	Het
Arid3a	T	C	10: 79,951,778	S550P	unknown	Het
Armc2	T	G	10: 41,975,408	E259D	probably benign	Het
Atp13a2	A	G	4: 141,002,053	D566G	probably damaging	Het
Bnc2	A	G	4: 84,555,874	C12R	probably benign	Het
Btbd16	C	T	7: 130,815,786	R344C	probably damaging	Het
Cc2d2b	C	T	19: 40,765,401	R123*	probably null	Het
Cdc37l1	T	A	19: 29,012,002	H286Q	possibly damaging	Het
Cfap54	A	T	10: 92,984,235	L1239Q	possibly damaging	Het
Cfap58	T	C	19: 47,986,554		probably null	Het
Col6a3	A	T	1: 90,778,844	D2789E	unknown	Het
Dazl	A	G	17: 50,283,150	V271A	probably benign	Het
Dennd4c	A	T	4: 86,837,400	N1610Y	probably benign	Het
Dusp13	T	A	14: 21,742,688	K56N	probably benign	Het
Erbb2	T	A	11: 98,422,058	I149N	probably damaging	Het
Erbb4	A	T	1: 68,349,393	C217S	probably damaging	Het
Fbxw21	A	G	9: 109,156,345	C122R	probably damaging	Het
Fktn	G	A	4: 53,734,854	G125D	probably benign	Het
Foxm1	T	A	6: 128,367,335	I182N	probably damaging	Het
Ggnbp2	T	C	11: 84,840,060	N381S	possibly damaging	Het
Gja3	T	C	14: 57,036,591	E108G	probably benign	Het
Gm40460	C	A	7: 142,240,762	G106V	unknown	Het
Gm9736	A	G	10: 77,751,015	C114R	unknown	Het
Gpbp1	A	T	13: 111,426,499	D492E	unknown	Het
Gper1	T	C	5: 139,426,557	V219A	possibly damaging	Het
Gtf2e1	C	T	16: 37,536,002	R56Q	probably benign	Het
Hist1h2af	T	C	13: 23,533,981	L24P	probably damaging	Het
Ide	T	C	19: 37,330,499	N38S		Het
Kat6a	T	A	8: 22,940,056	M1809K	unknown	Het
Kif7	A	T	7: 79,706,837	M702K	probably benign	Het
Lrrtm4	T	A	6: 80,022,443	N279K	probably damaging	Het
Mcrip1	G	A	11: 120,544,716	P31L	probably damaging	Het
Nrde2	G	T	12: 100,151,259	T47K	probably benign	Het
Olfr1135	C	T	2: 87,671,969	V133I	probably benign	Het
Olfr1415	T	G	1: 92,491,689	E22A	probably benign	Het
Olfr802	T	C	10: 129,682,416	T108A	probably benign	Het
Ppargc1a	G	A	5: 51,494,804	T184I	possibly damaging	Het
Ppp1r15a	T	C	7: 45,524,496	D296G	probably damaging	Het
Prl7c1	C	T	13: 27,780,768		probably benign	Het
Prss42	G	T	9: 110,799,160	R124L	possibly damaging	Het
Psmd1	T	G	1: 86,137,095	Y950D	probably damaging	Het
Ptprr	A	T	10: 116,188,214	L250F	possibly damaging	Het
Rabgef1	T	A	5: 130,208,713	M208K	possibly damaging	Het
Rps6ka2	A	G	17: 7,170,394	Y17C	probably damaging	Het
Rrnad1	A	G	3: 87,923,888	I444T	probably benign	Het
Sec23ip	T	A	7: 128,761,502	C463S	probably damaging	Het
Serpina3n	A	G	12: 104,413,451	T368A	probably damaging	Het
Sez6l	C	T	5: 112,461,217	A589T	probably benign	Het
Spag5	T	A	11: 78,301,997	Y52N	possibly damaging	Het
Tenm3	G	A	8: 48,335,513	S494L	unknown	Het
Top3b	T	C	16: 16,883,435	Y204H	probably damaging	Het
Trim43b	C	T	9: 89,091,399	V94M	possibly damaging	Het
Trps1	T	G	15: 50,661,262	I1091L	probably damaging	Het
Ttk	G	A	9: 83,843,688	R221Q	probably damaging	Het
Ttn	A	C	2: 76,719,122	M31737R	probably damaging	Het
Uso1	T	A	5: 92,187,266	L495*	probably null	Het
Usp19	A	G	9: 108,495,085	D447G	possibly damaging	Het
Zdhhc2	A	G	8: 40,467,522	E274G	probably damaging	Het
Zfp106	T	A	2: 120,520,454	Y1595F	probably damaging	Het
Zfp932	A	T	5: 110,009,654	H406L	probably damaging	Het

Other mutations in Nf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Nf1	APN	11	79395905	missense	probably damaging	0.99
IGL00801:Nf1	APN	11	79428700	splice site	probably benign
IGL00823:Nf1	APN	11	79565517	missense	probably damaging	1.00
IGL00945:Nf1	APN	11	79469803	missense	probably damaging	0.99
IGL00960:Nf1	APN	11	79445121	missense	probably damaging	1.00
IGL01118:Nf1	APN	11	79546986	missense	probably damaging	0.99
IGL01604:Nf1	APN	11	79441709	splice site	probably benign
IGL01637:Nf1	APN	11	79547120	missense	probably damaging	1.00
IGL01659:Nf1	APN	11	79559449	missense	probably benign
IGL01764:Nf1	APN	11	79384187	missense	probably benign
IGL01772:Nf1	APN	11	79390249	missense	probably damaging	1.00
IGL02047:Nf1	APN	11	79425535	missense	probably benign	0.04
IGL02052:Nf1	APN	11	79412727	missense	probably damaging	1.00
IGL02071:Nf1	APN	11	79444121	missense	possibly damaging	0.96
IGL02312:Nf1	APN	11	79444648	missense	possibly damaging	0.95
IGL02341:Nf1	APN	11	79564926	missense	probably benign	0.33
IGL02390:Nf1	APN	11	79565935	missense	possibly damaging	0.64
IGL02390:Nf1	APN	11	79411676	splice site	probably benign
IGL02475:Nf1	APN	11	79535667	missense	probably damaging	1.00
IGL02567:Nf1	APN	11	79547143	missense	probably damaging	1.00
IGL02571:Nf1	APN	11	79428627	missense	probably damaging	1.00
IGL02664:Nf1	APN	11	79444598	critical splice acceptor site	probably null
IGL02664:Nf1	APN	11	79444599	critical splice acceptor site	probably null
IGL02992:Nf1	APN	11	79434933	splice site	probably benign
IGL03006:Nf1	APN	11	79545431	missense	probably damaging	1.00
IGL03216:Nf1	APN	11	79564895	missense	probably benign	0.17
Diesel	UTSW	11	79556723	missense	probably damaging	0.96
Franklin	UTSW	11	79473320	splice site	probably null
Gasoline	UTSW	11	79556789	missense	probably benign	0.17
hancock	UTSW	11	79536850	missense	probably benign
independence	UTSW	11	79454310	intron	probably benign
jackson	UTSW	11	79447572	missense	probably damaging	1.00
Jefferson	UTSW	11	79446864	missense	probably damaging	1.00
Phyletic_dwarf	UTSW	11	79454189	missense	probably damaging	1.00
responsibility	UTSW	11	79565975	missense	probably damaging	0.99
C9142:Nf1	UTSW	11	79556731	missense	probably damaging	0.98
I2289:Nf1	UTSW	11	79547776	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0081:Nf1	UTSW	11	79453979	splice site	probably benign
R0115:Nf1	UTSW	11	79468876	critical splice donor site	probably null
R0144:Nf1	UTSW	11	79547127	missense	probably damaging	1.00
R0196:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R0196:Nf1	UTSW	11	79578272	missense	probably damaging	1.00
R0217:Nf1	UTSW	11	79428574	splice site	probably benign
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0255:Nf1	UTSW	11	79408699	splice site	probably null
R0362:Nf1	UTSW	11	79536878	missense	probably damaging	1.00
R0364:Nf1	UTSW	11	79441957	nonsense	probably null
R0464:Nf1	UTSW	11	79556789	missense	probably benign	0.17
R0511:Nf1	UTSW	11	79438769	missense	probably benign	0.01
R0549:Nf1	UTSW	11	79468771	missense	probably damaging	0.99
R0585:Nf1	UTSW	11	79568701	missense	probably damaging	0.99
R0636:Nf1	UTSW	11	79535703	missense	probably damaging	0.99
R0924:Nf1	UTSW	11	79453866	missense	probably damaging	0.98
R0942:Nf1	UTSW	11	79438711	missense	probably benign	0.00
R1022:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1024:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1350:Nf1	UTSW	11	79412687	missense	probably damaging	1.00
R1365:Nf1	UTSW	11	79547885	splice site	probably null
R1395:Nf1	UTSW	11	79535983	missense	possibly damaging	0.49
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1477:Nf1	UTSW	11	79395859	nonsense	probably null
R1508:Nf1	UTSW	11	79440909	missense	probably damaging	1.00
R1512:Nf1	UTSW	11	79390369	missense	probably damaging	1.00
R1605:Nf1	UTSW	11	79440923	missense	probably benign	0.01
R1680:Nf1	UTSW	11	79550998	nonsense	probably null
R1704:Nf1	UTSW	11	79463301	splice site	probably null
R1707:Nf1	UTSW	11	79535604	missense	probably damaging	1.00
R1741:Nf1	UTSW	11	79443931	missense	probably benign
R1761:Nf1	UTSW	11	79384265	missense	probably damaging	1.00
R1800:Nf1	UTSW	11	79553968	missense	possibly damaging	0.94
R1873:Nf1	UTSW	11	79547161	missense	probably damaging	1.00
R1966:Nf1	UTSW	11	79411564	missense	possibly damaging	0.72
R1967:Nf1	UTSW	11	79412745	missense	probably damaging	0.96
R1970:Nf1	UTSW	11	79553961	missense	probably benign	0.08
R2059:Nf1	UTSW	11	79556723	missense	probably damaging	0.96
R2105:Nf1	UTSW	11	79469826	missense	possibly damaging	0.50
R2151:Nf1	UTSW	11	79447570	missense	possibly damaging	0.94
R2211:Nf1	UTSW	11	79444064	missense	probably benign	0.39
R2497:Nf1	UTSW	11	79443884	missense	probably damaging	1.00
R2899:Nf1	UTSW	11	79412758	missense	possibly damaging	0.93
R3086:Nf1	UTSW	11	79546986	missense	probably damaging	1.00
R3120:Nf1	UTSW	11	79564899	missense	probably damaging	0.99
R3744:Nf1	UTSW	11	79548747	missense	probably benign	0.23
R3801:Nf1	UTSW	11	79559521	missense	probably null	0.98
R3804:Nf1	UTSW	11	79559521	missense	probably null	0.98
R4212:Nf1	UTSW	11	79469798	missense	probably damaging	1.00
R4298:Nf1	UTSW	11	79384244	missense	probably damaging	1.00
R4578:Nf1	UTSW	11	79445759	missense	probably damaging	1.00
R4579:Nf1	UTSW	11	79468757	missense	probably damaging	1.00
R4587:Nf1	UTSW	11	79536037	critical splice donor site	probably null
R4793:Nf1	UTSW	11	79447572	missense	probably damaging	1.00
R4834:Nf1	UTSW	11	79546297	missense	probably damaging	1.00
R4863:Nf1	UTSW	11	79409409	missense	probably damaging	1.00
R4967:Nf1	UTSW	11	79565553	critical splice donor site	probably null
R4971:Nf1	UTSW	11	79444643	missense	probably damaging	1.00
R5034:Nf1	UTSW	11	79444150	missense	probably damaging	0.98
R5036:Nf1	UTSW	11	79446864	missense	probably damaging	1.00
R5207:Nf1	UTSW	11	79454189	missense	probably damaging	1.00
R5348:Nf1	UTSW	11	79564899	missense	probably damaging	1.00
R5356:Nf1	UTSW	11	79473456	missense	possibly damaging	0.94
R5444:Nf1	UTSW	11	79443959	missense	possibly damaging	0.94
R5533:Nf1	UTSW	11	79445789	missense	probably damaging	0.99
R5918:Nf1	UTSW	11	79569222	intron	probably benign
R5978:Nf1	UTSW	11	79540419	missense	probably damaging	1.00
R6140:Nf1	UTSW	11	79473320	splice site	probably null
R6195:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6216:Nf1	UTSW	11	79411607	missense	possibly damaging	0.93
R6233:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6257:Nf1	UTSW	11	79549491	missense	probably damaging	1.00
R6258:Nf1	UTSW	11	79565755	splice site	probably null
R6756:Nf1	UTSW	11	79444587	splice site	probably null
R6878:Nf1	UTSW	11	79434882	missense	probably damaging	1.00
R6959:Nf1	UTSW	11	79549468	missense	probably damaging	0.98
R7007:Nf1	UTSW	11	79447023	splice site	probably null
R7066:Nf1	UTSW	11	79556720	missense	probably damaging	1.00
R7099:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R7213:Nf1	UTSW	11	79469819	missense	probably benign	0.23
R7326:Nf1	UTSW	11	79564943	missense	probably benign
R7348:Nf1	UTSW	11	79536850	missense	probably benign
R7380:Nf1	UTSW	11	79546276	missense	probably damaging	1.00
R7407:Nf1	UTSW	11	79448143	missense	probably damaging	1.00
R7412:Nf1	UTSW	11	79473414	missense	probably damaging	1.00
R7545:Nf1	UTSW	11	79409524	missense	probably benign
R7567:Nf1	UTSW	11	79547226	missense	probably damaging	0.99
R7574:Nf1	UTSW	11	79408769	missense	probably null	0.99
R7616:Nf1	UTSW	11	79384266	missense	probably damaging	0.97
R7713:Nf1	UTSW	11	79425606	missense	probably benign
R7737:Nf1	UTSW	11	79545488	missense	probably benign	0.33
R7869:Nf1	UTSW	11	79418588	missense	probably damaging	1.00
R7905:Nf1	UTSW	11	79547112	missense	possibly damaging	0.80
R8232:Nf1	UTSW	11	79578331	missense	probably damaging	0.96
R8244:Nf1	UTSW	11	79440924	missense	probably benign
R8397:Nf1	UTSW	11	79547692	missense	probably damaging	1.00
R8436:Nf1	UTSW	11	79458883	missense	probably damaging	0.99
R8492:Nf1	UTSW	11	79408422	missense	probably benign	0.06
R8719:Nf1	UTSW	11	79390293	missense	possibly damaging	0.86
R8735:Nf1	UTSW	11	79454310	intron	probably benign
R8795:Nf1	UTSW	11	79425616	missense	probably damaging	1.00
R8797:Nf1	UTSW	11	79475885	critical splice donor site	probably benign
R8809:Nf1	UTSW	11	79547138	missense	probably damaging	0.99
R8812:Nf1	UTSW	11	79546354	missense	probably damaging	0.96
R8815:Nf1	UTSW	11	79441665	missense	probably damaging	1.00
R8828:Nf1	UTSW	11	79395853	critical splice acceptor site	probably null
R8894:Nf1	UTSW	11	79445793	missense	probably damaging	1.00
R9051:Nf1	UTSW	11	79473342	missense	probably damaging	1.00
R9103:Nf1	UTSW	11	79559506	missense	probably damaging	0.99
R9142:Nf1	UTSW	11	79475862	missense	probably damaging	1.00
R9170:Nf1	UTSW	11	79545465	missense	probably damaging	1.00
R9201:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R9267:Nf1	UTSW	11	79440890	missense	possibly damaging	0.72
R9309:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R9340:Nf1	UTSW	11	79556803	missense	possibly damaging	0.90
R9398:Nf1	UTSW	11	79547192	missense	probably damaging	0.99
R9471:Nf1	UTSW	11	79545369	missense	probably damaging	0.99
X0052:Nf1	UTSW	11	79559416	missense	probably damaging	0.99
Z1177:Nf1	UTSW	11	79564925	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTACACTGAGGGCATAAGGC -3'
(R):5'- CATGTGAATCTGCGCTTCTC -3'

Sequencing Primer
(F):5'- GCATAAGGCCCCCTCCTTTG -3'
(R):5'- GCGCTTCTCTTTCCAAATCATAATAC -3'

Posted On

2022-01-20