Incidental Mutation 'R9142:Nrde2'
ID 694415
Institutional Source Beutler Lab
Gene Symbol Nrde2
Ensembl Gene ENSMUSG00000021179
Gene Name nrde-2 necessary for RNA interference, domain containing
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9142 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 100125452-100159653 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 100151259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 47 (T47K)
Ref Sequence ENSEMBL: ENSMUSP00000152698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021596] [ENSMUST00000221954]
AlphaFold Q80XC6
Predicted Effect possibly damaging
Transcript: ENSMUST00000021596
AA Change: T47K

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021596
Gene: ENSMUSG00000021179
AA Change: T47K

DomainStartEndE-ValueType
low complexity region 85 107 N/A INTRINSIC
low complexity region 146 154 N/A INTRINSIC
Pfam:NRDE-2 318 658 1.2e-107 PFAM
Blast:HAT 765 800 2e-10 BLAST
Blast:HAT 802 841 3e-16 BLAST
Blast:HAT 986 1018 3e-10 BLAST
Blast:HAT 1075 1109 1e-14 BLAST
Blast:HAT 1111 1143 8e-15 BLAST
low complexity region 1154 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221954
AA Change: T47K

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,297,893 D929E probably damaging Het
Adprhl2 C A 4: 126,321,567 G35V probably damaging Het
Apob A C 12: 8,012,705 D3729A possibly damaging Het
App G A 16: 85,103,239 H108Y probably damaging Het
Arap3 G A 18: 37,979,881 A1092V possibly damaging Het
Arid3a T C 10: 79,951,778 S550P unknown Het
Armc2 T G 10: 41,975,408 E259D probably benign Het
Atp13a2 A G 4: 141,002,053 D566G probably damaging Het
Bnc2 A G 4: 84,555,874 C12R probably benign Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Cc2d2b C T 19: 40,765,401 R123* probably null Het
Cdc37l1 T A 19: 29,012,002 H286Q possibly damaging Het
Cfap54 A T 10: 92,984,235 L1239Q possibly damaging Het
Cfap58 T C 19: 47,986,554 probably null Het
Col6a3 A T 1: 90,778,844 D2789E unknown Het
Dazl A G 17: 50,283,150 V271A probably benign Het
Dennd4c A T 4: 86,837,400 N1610Y probably benign Het
Dusp13 T A 14: 21,742,688 K56N probably benign Het
Erbb2 T A 11: 98,422,058 I149N probably damaging Het
Erbb4 A T 1: 68,349,393 C217S probably damaging Het
Fbxw21 A G 9: 109,156,345 C122R probably damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Foxm1 T A 6: 128,367,335 I182N probably damaging Het
Ggnbp2 T C 11: 84,840,060 N381S possibly damaging Het
Gja3 T C 14: 57,036,591 E108G probably benign Het
Gm40460 C A 7: 142,240,762 G106V unknown Het
Gm9736 A G 10: 77,751,015 C114R unknown Het
Gpbp1 A T 13: 111,426,499 D492E unknown Het
Gper1 T C 5: 139,426,557 V219A possibly damaging Het
Gtf2e1 C T 16: 37,536,002 R56Q probably benign Het
Hist1h2af T C 13: 23,533,981 L24P probably damaging Het
Ide T C 19: 37,330,499 N38S Het
Kat6a T A 8: 22,940,056 M1809K unknown Het
Kif7 A T 7: 79,706,837 M702K probably benign Het
Lrrtm4 T A 6: 80,022,443 N279K probably damaging Het
Mcrip1 G A 11: 120,544,716 P31L probably damaging Het
Nf1 T A 11: 79,471,489 S1497R probably damaging Het
Nf1 T A 11: 79,475,862 I1607N probably damaging Het
Olfr1135 C T 2: 87,671,969 V133I probably benign Het
Olfr1415 T G 1: 92,491,689 E22A probably benign Het
Olfr802 T C 10: 129,682,416 T108A probably benign Het
Ppargc1a G A 5: 51,494,804 T184I possibly damaging Het
Ppp1r15a T C 7: 45,524,496 D296G probably damaging Het
Prl7c1 C T 13: 27,780,768 probably benign Het
Prss42 G T 9: 110,799,160 R124L possibly damaging Het
Psmd1 T G 1: 86,137,095 Y950D probably damaging Het
Ptprr A T 10: 116,188,214 L250F possibly damaging Het
Rabgef1 T A 5: 130,208,713 M208K possibly damaging Het
Rps6ka2 A G 17: 7,170,394 Y17C probably damaging Het
Rrnad1 A G 3: 87,923,888 I444T probably benign Het
Sec23ip T A 7: 128,761,502 C463S probably damaging Het
Serpina3n A G 12: 104,413,451 T368A probably damaging Het
Sez6l C T 5: 112,461,217 A589T probably benign Het
Spag5 T A 11: 78,301,997 Y52N possibly damaging Het
Tenm3 G A 8: 48,335,513 S494L unknown Het
Top3b T C 16: 16,883,435 Y204H probably damaging Het
Trim43b C T 9: 89,091,399 V94M possibly damaging Het
Trps1 T G 15: 50,661,262 I1091L probably damaging Het
Ttk G A 9: 83,843,688 R221Q probably damaging Het
Ttn A C 2: 76,719,122 M31737R probably damaging Het
Uso1 T A 5: 92,187,266 L495* probably null Het
Usp19 A G 9: 108,495,085 D447G possibly damaging Het
Zdhhc2 A G 8: 40,467,522 E274G probably damaging Het
Zfp106 T A 2: 120,520,454 Y1595F probably damaging Het
Zfp932 A T 5: 110,009,654 H406L probably damaging Het
Other mutations in Nrde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Nrde2 APN 12 100130931 missense probably benign 0.01
IGL02697:Nrde2 APN 12 100131207 missense probably damaging 1.00
IGL02798:Nrde2 APN 12 100143822 nonsense probably null
IGL02810:Nrde2 APN 12 100143758 missense possibly damaging 0.81
IGL02814:Nrde2 APN 12 100144135 missense probably null 0.80
IGL02990:Nrde2 APN 12 100142096 missense probably damaging 1.00
kurtz UTSW 12 100134405 missense possibly damaging 0.92
R0090:Nrde2 UTSW 12 100129286 splice site probably benign
R0576:Nrde2 UTSW 12 100132233 missense possibly damaging 0.82
R0646:Nrde2 UTSW 12 100143846 nonsense probably null
R1130:Nrde2 UTSW 12 100125670 missense probably damaging 0.97
R1216:Nrde2 UTSW 12 100149810 splice site probably benign
R1661:Nrde2 UTSW 12 100149860 missense probably benign 0.19
R2069:Nrde2 UTSW 12 100142232 missense probably damaging 1.00
R4405:Nrde2 UTSW 12 100130584 missense probably benign 0.01
R4422:Nrde2 UTSW 12 100146027 nonsense probably null
R5169:Nrde2 UTSW 12 100129293 critical splice donor site probably null
R5200:Nrde2 UTSW 12 100130497 missense possibly damaging 0.77
R5338:Nrde2 UTSW 12 100130778 missense probably damaging 1.00
R5512:Nrde2 UTSW 12 100142250 missense probably benign 0.20
R5820:Nrde2 UTSW 12 100132287 missense probably benign 0.00
R6019:Nrde2 UTSW 12 100132242 missense probably benign 0.04
R6346:Nrde2 UTSW 12 100132306 missense probably benign 0.01
R6378:Nrde2 UTSW 12 100130757 missense probably damaging 0.99
R6479:Nrde2 UTSW 12 100143948 missense probably benign 0.00
R6523:Nrde2 UTSW 12 100134405 missense possibly damaging 0.92
R7073:Nrde2 UTSW 12 100132488 missense probably benign 0.00
R7220:Nrde2 UTSW 12 100130919 missense probably benign 0.05
R7412:Nrde2 UTSW 12 100142250 nonsense probably null
R7505:Nrde2 UTSW 12 100132498 missense probably benign 0.15
R7699:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7700:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7733:Nrde2 UTSW 12 100144140 missense possibly damaging 0.92
R7868:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
R7963:Nrde2 UTSW 12 100149868 missense probably damaging 0.99
R8131:Nrde2 UTSW 12 100142243 missense probably benign 0.02
R8213:Nrde2 UTSW 12 100131003 missense probably benign
R9061:Nrde2 UTSW 12 100143864 missense probably benign 0.00
R9371:Nrde2 UTSW 12 100126218 missense probably benign 0.09
R9412:Nrde2 UTSW 12 100130422 nonsense probably null
R9468:Nrde2 UTSW 12 100140009 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGGAAGATGGTCACAGATTGCC -3'
(R):5'- ATTCCACTTGGTTTCTGCGG -3'

Sequencing Primer
(F):5'- AGATTGCCTGGTCCACTGG -3'
(R):5'- ACTGCACAAGATACTGGCTG -3'
Posted On 2022-01-20