Mutagenetix > Incidental Mutation

Incidental Mutation 'V7580:Olfr1440'

69442

Institutional Source

Beutler Lab

Gene Symbol

Olfr1440

Ensembl Gene

ENSMUSG00000046650

Gene Name

olfactory receptor 1440

Synonyms

MOR215-1, GA_x6K02T2RE5P-2725206-2726153

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

V7580 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12387279-12401584 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 12394550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 96 (V96I)

Ref Sequence

ENSEMBL: ENSMUSP00000148978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054567] [ENSMUST00000213657] [ENSMUST00000213894] [ENSMUST00000216145] [ENSMUST00000217062]

AlphaFold

Q8VFV4

Predicted Effect

probably benign
Transcript: ENSMUST00000054567
AA Change: V96I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000054798
Gene: ENSMUSG00000046650
AA Change: V96I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	7.5e-52	PFAM
Pfam:7tm_1	42	291	7.2e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208644
AA Change: V96I

Predicted Effect

probably benign
Transcript: ENSMUST00000213657
AA Change: V96I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000213894
AA Change: V96I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214082

Predicted Effect

probably benign
Transcript: ENSMUST00000216145
AA Change: V96I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216169

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216773

Predicted Effect

probably benign
Transcript: ENSMUST00000217062
AA Change: V96I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Med20	G	A	17: 47,618,832	V65M	probably damaging	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Olfr1440

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02104:Olfr1440	APN	19	12394899	missense	probably damaging	0.97
IGL02517:Olfr1440	APN	19	12394901	missense	probably benign
IGL03173:Olfr1440	APN	19	12395046	missense	possibly damaging	0.79
IGL03412:Olfr1440	APN	19	12394379	missense	probably damaging	1.00
F5770:Olfr1440	UTSW	19	12394550	missense	probably benign	0.19
R0240:Olfr1440	UTSW	19	12394963	missense	probably benign	0.01
R0240:Olfr1440	UTSW	19	12394963	missense	probably benign	0.01
R1184:Olfr1440	UTSW	19	12394857	missense	probably benign	0.02
R1430:Olfr1440	UTSW	19	12394437	missense	probably benign	0.34
R4111:Olfr1440	UTSW	19	12394301	missense	probably damaging	1.00
R5751:Olfr1440	UTSW	19	12394416	missense	probably benign	0.01
R6796:Olfr1440	UTSW	19	12394928	missense	probably damaging	0.99
R7392:Olfr1440	UTSW	19	12394465	missense	probably damaging	1.00
R8048:Olfr1440	UTSW	19	12394355	missense	not run
R9612:Olfr1440	UTSW	19	12394619	missense	probably damaging	0.99
Z1088:Olfr1440	UTSW	19	12394299	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- GTGTGGAACTTGGGCCTCATCATC -3'
(R):5'- TAACCCTGGGAACTGTTGGAGCTG -3'

Sequencing Primer
(F):5'- GGATTGACCCTTACCTACACAC -3'
(R):5'- GTATTGAATGCCTTGGACCTAC -3'

Posted On

2013-09-04